The selected strains were used for loxP excision analysis. These procedures are schematically drawn in Fig. 4A. loxP excision analysis by PCR Cells were lysed in guanidine solution (4 M guanidine thiocyanate, 0.5% N-lauroyl sarcosine sodium, 25 mM Tris-HCl pH 8.0, 0.1 M 2-mercaptoethanol) and genomic DNA was extracted by conventional extraction with phenol/chloroform (1:1) and precipitated with isopropanol. The loxP-neo4-loxP-EGFP-TWI1 locus

or the neo4-excised loxP-EGFP-TWI1 locus was detected using the PCR Extender System (5-PRIME) with the primers TWI15LoxFW and EGFP-NtermRV. Observation of EGFP-Twi1p loxP-EGFP-TWI1 cells were mated with the wild-type B2086 strain. Cells were fixed and stored in 25% methanol and 10% formaldehyde over night at 4°C. The samples were incubated with 10 ng/mL DAPI and observed by selleck compound fluorescence microscopy. Acknowledgements We thank all the members

of the Mochizuki group for their useful discussion. The research leading to these results received funding from the European Research Council (ERC) Starting Grant (204986) under the European Community’s Seventh Framework Program and from the Austrian Academy of Sciences to KM. Electronic supplementary material Additional file 1: Supplementary Figure S1 and plasmid DNA sequences. Supplementary Figure S1 describing construction and analyses of a Tetrahymena strain expressing Cre-recombinase from BTU1 locus, and DNA sequences of pMNMM3, pMNMM3-HA-cre1 and pBNMB-HA-cre1 (PDF 360 KB) References 1. Brizzard B: Epitope tagging. BioTechniques 2008,44(5):693–695.PubMedCrossRef 2. Cassidy-Hanley GW786034 chemical structure D, Bowen J,

Lee JH, Cole E, VerPlank LA, Gaertig J, Gorovsky MA, Bruns PJ: Germline and somatic transformation of mating Tetrahymena thermophila by particle bombardment. Mirabegron Genetics 1997,146(1):135–147.PubMed 3. Aronica L, Bednenko J, Noto T, Desouza LV, Siu KW, Loidl J, Pearlman RE, Gorovsky MA, Mochizuki K: Study of an RNA helicase implicates small RNA-noncoding RNA interactions in programmed DNA elimination in Tetrahymena. Genes & development 2008,22(16):2228–2241.CrossRef 4. Tsao CC, Gorovsky MA: Tetrahymena IFT122A is not essential for cilia assembly but plays a role in returning IFT proteins from the ciliary tip to the cell body. Journal of cell science 2008,121(Pt 4):428–436.PubMedCrossRef 5. Kurth HM, Mochizuki K: 2′-O-methylation stabilizes Piwi-associated small RNAs and ensures DNA elimination in Tetrahymena. RNA (New York, NY) 2009,15(4):675–685. 6. Eisen JA, Coyne RS, Wu M, Wu D, Thiagarajan M, Wortman JR, Badger JH, Ren Q, Amedeo P, Jones KM, et al.: Macronuclear genome sequence of the ciliate Tetrahymena thermophila, a model eukaryote. PLoS biology 2006,4(9):e286.PubMedCrossRef 7. Wiley EA, Ohba R, Yao MC, Allis CD: Developmentally regulated rpd3p homolog specific to the transcriptionally active macronucleus of vegetative Tetrahymena thermophila.

We assign this faster-decaying, shorter-wavelength component with a maximum at 980 nm to Car D2 ∙+ . Although CarD2 has been proposed to be the initial electron donor in the pathway of secondary electron transfer (Lakshmi et al. 2003; Tracewell and Brudvig 2003), the specific spectral perturbations of site-directed mutations near CarD2 on the 980 nm Car∙+ species provide the first direct evidence that CarD2 is one of the redox-active Car in PSII. Previous studies have shown that the maximum of the Car∙+ near-IR peak shifts to a slightly shorter wavelength when YD is oxidized to Y D ∙ in all PSII centers (Tracewell

and Brudvig 2003). It RAD001 chemical structure was hypothesized that this was either due to an electrochromic shift caused by YD or due to biasing electron transfer so that the redox-active Car closest to Y D ∙ would remain reduced to avoid electrostatic repulsion. However, it has been observed that electrochromic shifts propagate substantial distances through PSII. For example, generating Q A − affects

the visible spectrum of BA, the accessory Chl near PA of P680, from 21 Å away, and also possibly affects the spectrum of BB, 29 Å away (Stewart et al. 2000). HSP inhibitor Although Y D ∙ would most likely have a smaller electrochromic effect than Q A – , its effects do propagate at least as far as P680 (Diner and Rappaport 2002). CarD2 is approximately 25 Å from YD. Alternatively, there are several Car cofactors in CP47 that are at a comparable or even shorter distance from YD; one Car in CP47 is 21 Å from

YD, another is 27 Å away, and two others are about 30 Å from YD. Due to closely spaced distances, an electrochromic shift would not be a definitive indicator of which Car is oxidized, even if it were observable at those distances. It is also possible that oxidation of YD may bias the path of secondary electron transfer. To pull an electron from one of the Car in CP47, two intermediate Chl∙+ would be involved that are each 20 Å from Y D ∙ , to ultimately generate a terminal Car∙+ that may be as close as 21 Å to Y D ∙ . Under these conditions, the 980 nm Car D2 ∙+ may be a more stable radical than the 999 nm Car∙+, resulting in a net shift of the Car∙+ peak to a shorter wavelengths. The near-IR Farnesyltransferase spectra of D2-G47W, D2-G47F, and D2-T50F PSII samples contain a relatively larger amount of the Chl∙+ peak as compared to the Car∙+ peak than WT PSII samples (Fig. 4B). One possibility is that the mutations around the headgroup of CarD2 caused a shift of the reduction potential of Car D2 ∙+ to a higher value, making it more difficult to oxidize CarD2 relative to other Chl and Car cofactors. This would destabilize Car D2 ∙+ , which is the predominant donor in the charge separation (980 nm Car∙+, see Fig. 5; Table 1), thus favoring Chl∙+ in a greater portion of PSII centers.

J Appl Phys 2007, 101:1–9.CrossRef 14. Oliver DJ, Bradby JE, Williams JS, Swain MV, Munroe P: Thickness-dependent phase transformation in nanoindented germanium thin films. Nanotechnology

2008, 19:1–8. 15. Oliver DJ, Bradby JE, Williams JS, Swain MV, Munroe P: Rate-dependent phase transformations in nanoindented germanium. J Appl Phys 2009, 105:1–3.CrossRef 16. Zhu PZ, Fang FZ: Molecular dynamics simulations of nanoindentation of monocrystalline germanium. Appl Phys A-Mater 2012, 108:415–421.CrossRef 17. Tersoff J: Modeling solid-state chemistry: interatomic potentials for multicomponent systems. Phys Rev B 1989, 39:5566–5568.CrossRef 18. Fang FZ, Wu Tucidinostat datasheet H, Liu YC: Modeling and experimental investigation on nanometric cutting of monocrystalline silicon. Int J Mach Tools Manu 2005, 45:1681–1686.CrossRef 19. Lai M, Zhang XD, Fang FZ, Wang YF, Feng M, Tian WH: Study on nanometric cutting of germanium by molecular dynamics simulation. Nanoscale Res Lett 2013, 8:13–22.CrossRef 20. Jamieson JC: Crystal structures at high pressures of metallic modifications of silicon and germanium. Science 1963, 139:762–764.CrossRef 21. Bundy FP, Kasper JS: A new form of solid germanium. Science 1963, 139:340–341.CrossRef 22. Bates CH, Dachille F, Roy R: High-pressure transitions of germanium and a new high-pressure form of

germanium. Science 1963, 147:860–862.CrossRef 23. Nelmes RJ, McMahon MI, Wright NG, Allan DR, Loveday JS: Stability and crystal structure of BCS germanium. Phys Rev B 1993, 48:9883–9886.CrossRef Selonsertib price 24. Cui HB, Graf D, Brooks JS, Kobayashi H: Pressure-dependent metallic and superconducting phases in a germanium artificial metal. Phys Rev Lett Mephenoxalone 2009, 102:1–4. 25. Mylvaganam K, Zhang LC: Effect of oxygen penetration in silicon due to nano-indentation. Nanotechnology 2002, 13:623–626.CrossRef 26. Boyer LL, Kaxiras E, Feldman JL, Broughton JQ, Mehl MJ: New low-energy crystal structure

for silicon. Phys Rev Lett 1991, 67:715–718.CrossRef 27. Bording JK: Molecular-dynamics simulation of Ge rapidly cooled from the molten state into the amorphous state. Phys Rev B 2000, 62:7103–7109.CrossRef 28. Mujica A, Needs RJ, Mujica A, Needs RJ: First-principles calculations of the structural properties, stability, and band structure of complex tetrahedral phases of germanium: ST12 and BC8. Phys Rev B 1993,48(23):17010–17017.CrossRef 29. Durandurdu M, Drabold DA: First-order pressure-induced polyamorphism in germanium. Phys Rev B 2002,66(041201):1–4. Competing interests The authors declare that they have no competing interests. Authors’ contributions FZF conceived of the research work and participated in the analyses. XDZ participated in its design, coordination, and analyses. ML carried out the molecular dynamics simulations of nanoindentation on monocrystalline germanium, analyzed the simulation results, and drafted the manuscript.

The effect of the synthesis medium on the photocatalytic efficiency of calcined ZnO nanoparticles

was explicitly noticed by the much higher efficiency of ZnOE than that of ZnOW in the photocatalytic degradation of cyanide ion in the aqueous medium under the same conditions. Table  4 shows that the photocatalytic activity of ZnOE is as approximately 1.5 as that of ZnOW when applying 0.02 wt.% concentration of the ZnO photocatalyst. The higher performance of ZnOE can be attributed to the higher adsorption capability of its particles, owing to its regular, polyhedral surface faces. Table 4 Effect of the synthesis medium on photocatalytic Selleck PF-01367338 activity Sample ZnO loading (wt.%) CN‾ degradation (%) ZnOE 0.02 86 ZnOW 0.02 56 The superiority of ZnOE photocatalytic activity can be correlated to its particle size and shape, as it is reported in the literature [42–45]. However, the effect of ZnO particle shape on the photocatalytic activity is rarely studied in the literature [46]. In this context, the edges and corners of ZnOE hexagonal particles have many coordinatively unsaturated sites, which usually are active in catalysis. On the other hand, the spherical shape of ZnOW find more particles would have much less active sites due to the lack of edges and corners. Aligning with our interpretation

of ZnOE photocatalytic activity, El-sayed and his coworkers, for instance, showed that the influence of the particle shape on the catalytic activity is very important toward better activity N-acetylglucosamine-1-phosphate transferase [42, 45]. In addition, the photocatalytic activity of acetaldehyde decomposition using ZnO powder depended on several factors including the morphology of the particles [46]. Finally, we believe that the morphology of our ZnOE particles is crucial in photocatalytic activity and our present findings will provide a hint about the role of morphology in the ZnOE photocatalytic

performance. Based on the obtained results, ZnOE nanoparticles were used in further investigation for improving the cyanide degradation efficiency. Photocatalytic degradation of CN- using different concentrations wt.% of calcined ZnOE Photocatalytic degradation of cyanide using different weight percent of calcined ZnOE was performed and found to depend on the ZnO concentration wt.%, as shown in Figure  7. It is evident that at the initial reaction stage, the catalyst concentration of ZnO has no notable effect on the catalytic performance, which might due to the high essential activity of the ZnOE catalyst. It is clear from Figure  6 that the smallest concentration of 0.01 wt.% ZnOE resulted in cyanide degradation of 85% after 180 min, while it increased remarkably to 95% with increasing the loading from 0.01 to 0.02 wt.%. However, further increase in the ZnOE concentration from 0.02 to 0.09 wt.% had resulted in almost 100% CN removal efficiency.

​ncbi.​nlm.​nih.​gov). T. rubrum dbEST consists of ESTs from this species deposited in the

public database. High-throughput scripts for the BLAST algorithms BLASTx and BLASTn [60] were used to search the nr-GenBank and T. rubrum dbEST, respectively, using the Blosum 62 matrix and default BLAST parameters. Similarity search against dbEST using the BLASTn algorithm, excluding the sequences previously Vactosertib deposited by our group, was regarded to be significant when the expected value (e-value) was less than 1e-20. For BLASTx searching, the top 5 scoring hits with e-values lower than 1e-3 were used to annotate each EST. Sequences that did not return alignments with the established e-value cut-offs were considered PLX-4720 clinical trial as no-matches. Our results were also compared to TrED database http://​www.​mgc.​ac.​cn/​TrED. The functional classification of these unigenes was performed according to the Functional Catalogue created by the Munich Information Center for Protein Sequences (MIPS), gathered through a BLAST comparison of the query sequence (unigenes) against MIPS-annotated proteins from Saccharomyces cerevisiae, Neurospora crassa, Fusarium graminearum, and Ustilago maydis [61, 62]. This retrieves the MIPS accession number from the best hit (considering a minimum e-value of 1e-3), which in turn retrieves the functional category from the MIPS FunCat table. All computer analyses

were performed on Intel-based computers

(P4 and Xeon) using the Linux-based operating system Fedora 6. The scripts and programs were developed using the PERL language, and the web pages were created using CGI, Javascript, and HTML. Acknowledgements This study was supported Liothyronine Sodium by grants from the Brazilian funding agencies FAPESP, CNPq, CAPES, and FAEPA. We thank Dr AL Fachin for providing the F6 strain. Electronic supplementary material Additional file 1: T. rubrum EST database. The data show the complete list of ESTs that are differentially expressed in T. rubrum under different experimental conditions. (PDF 174 KB) Additional file 2: T. rubrum unigenes database. The data show the complete list of unigenes that are differentially expressed in T. rubrum under each experimental condition, the novel T. rubrum genes (highlighted) and their MIPS categorization. (PDF 692 KB) References 1. Weitzman I, Summerbell RC: The Dermatophytes. Clin Microbiol Rev 1995, 8:240–259.PubMed 2. Seebacher C, Bouchara JP, Mignon B: Updates on the epidemiology of dermatophyte infections. Mycopathologia 2008, 166:335–352.PubMedCrossRef 3. Tsuboi R, Ko IJ, Takamori K, Ogawa H: Isolation of a keratinolytic proteinase from Trichophyton mentagrophytes with enzymatic activity at acidic pH. Infect Immun 1989, 57:3479–3483.PubMed 4. Blank IH: Measurement of pH of the skin surface. J Invest Dermatol 1939, 2:75–79.CrossRef 5.

e., converted to oxide. The above TEM observations clearly reveal that the growth and migration behaviors of Ge nanocrystallites are very sensitive to the presence and the content of Si interstitials that are provided either externally by adjacent Si3N4 layers or by small concentrations of residual Si interstitials remaining within the oxidized poly-SiGe pillars. The role of Si interstitials in the growth of Ge nanocrystallites under thermal annealing in an oxidizing ambient is sketched in Figures 2d, 3d, and 4c. Although a large body of work exists in the literature on the generation and role of Si interstitials, to our knowledge, the above phenomenon has never been reported before. Previous work has attributed the thermal oxidation

of Si inducing a drastic lateral expansion of the silicon lattice [12] and the generation of silicon self-interstitials NVP-BSK805 mw as a means of partially relieving the compressive stress in the growing oxide layer that develops as a result of a 2.25× volume expansion when Si is converted to SiO2. The majority of these Si interstitials generated during Si oxidation diffuse into the growing oxide layer and are also oxidized [13, 14], while a relatively small, but significant, amount of interstitials diffuse into the Si substrate,

causing supersaturation of these interstitials and the consequent precipitation as oxidation stacking faults (OSFs) [5, 6] or oxidation-enhanced diffusion (OED) [1, click here 2] of some dopants. Interestingly, the OED of boron during the thermal oxidation of Si is effectively suppressed through the introduction of a thin layer of Si1 – x Ge x or Si1 – x Ge x C y over the Si substrate or even completely eliminated when the Ge or C concentration is high [15–17]. Moreover, the reduction of the Si interstitials has been shown to be Ge concentration dependent. Again, to our knowledge, we have not found previous work describing a cooperative mechanism, wherein the Si interstitials aid in both the migration of Ge nanocrystallites and in the coarsening of these nanocrystallites through Ostwald ripening as clearly shown above. The additional, interesting aspect of this novel mechanism is that as described by us previously

[9, 10], the Ge nanocrystallites also appear to enhance the decomposition Pyruvate dehydrogenase of the Si-bearing Si3N4 layers resulting in further generation of Si interstitials. The quality of the oxide generated by the thermal oxidation of the poly-Si0.85Ge0.15 could also play a significant role in facilitating the new mechanism that we have discovered. Diffusion lengths of Si interstitials in SiO2 calculated at 900°C for diffusion times of 10, 40, 70, 100, and 145 min are 0.72, 1.43, 1,89, 2.26, and 2.72 nm, respectively, based on the equation of D = 1.2 × 10-9⋅exp(-1.9/k B T) [18]. Obviously, these diffusion lengths are too small to explain the Si interstitial-mediated mechanism that we have observed. Hence, we believe that the oxide generated from poly-Si0.85Ge0.

Acknowledgments This work was supported by the National Key Basic Research Program of China (2013CB922303, 2010CB833103), the National Natural Science Foundation of China (60976073, 11274201, 51231007), the 111 Project (B13029), the National Found for Fostering Talents of Basic Science (J1103212), and the Foundation for Outstanding Young Scientist in Shandong Province (BS2010CL036). References

1. O’Regan B, Grätzel M: A low-cost, high-efficiency solar cell based on dye-sensitized colloidal TiO2 films. Nature 1991, 335:737.CrossRef 2. Grätzel M: Photoelectrochemical cells. Nature 2001, 414:338.CrossRef 3. Yu JF, Wang D, Huang YN, Fan X, Tang X, Gao C, Li JL, Zou DC, Wu K: A cylindrical core-shell-like PFT�� ic50 TiO2 nanotube array anode for flexible fiber-type dye-sensitized solar cells. Nanoscale Res Lett 2011, 6:94.CrossRef 4. Thomas S, Evangelia

R, Chaido-Stefania K, Polycarpos F: Influence of electrolyte co-additives on the performance of dye-sensitized solar cells. Nanoscale Res Lett 2011, 6:307.CrossRef Blasticidin S price 5. Zukalova M, Zukal A, Kavan L, Nazeeruddin MK, Liska P, Gratzel M: Organized mesoporous TiO2 films exhibiting greatly enhanced performance in dye-sensitized solar cells. Nano Lett 2005, 5:1789.CrossRef 6. Yella A, Lee HW, Tsao HN, Yi C, Chandiran AK, Nazeeruddin MK, Diau EWG, Yeh CY, Zakeeruddin SM, Grätzel M: Porphyrin-sensitized solar cells with cobalt(II/III)-based redox electrolyte exceed 12 percent efficiency. Science 2011, 334:629.CrossRef

7. Wang CB, Jiang ZF, Wei L, Chen YX, Jiao J, Eastman M, Liu H: Photosensitization of TiO2 nanorods with CdS quantum dots for photovoltaic applications: a wet-chemical approach. Nano Energy 2012, 1:440.CrossRef 8. Diguna LJ, Shen Q, Kobayashi J, Toyoda T: High efficiency of CdSe quantum-dot-sensitized TiO2 inverse opal solar cells. Appl Phys Lett 2007, 91:023116.CrossRef 9. Nanu M, Schoonman J, Goossens A: Nanocomposite three-dimensional Methocarbamol solar cells obtained by chemical spray deposition. Nano Lett 2005, 5:1716.CrossRef 10. Yafit I, Olivia N, Miles P, Gary H: Sb2S3-sensitized nanoporous TiO2 solar cells. J Phys Chem C 2009, 113:4254.CrossRef 11. Sun M, Chen GD, Zhang YK, Wei Q, Ma ZM, Du B: Efficient degradation of azo dyes over Sb2S3/TiO2 heterojunction under visible light irradiation. Ind Eng Chem Res 2012, 51:2897.CrossRef 12. Antonio B, Sixto G, Isabella C, Alberto V, Ivan M: Panchromatic sensitized solar cells based on metal sulfide quantum dots grown directly on nanostructured TiO2 electrodes. J Phys Chem Lett 2011, 2:454.CrossRef 13. Wu J, Wang ZM, Dorogan VG, Li SB, Zhou ZH, Li HD, Lee JH, Kim ES, Mazur YI, Salamo GJ: Strain-free ring-shaped nanostructures by droplet epitaxy for photovoltaic application. Appl Phys Lett 2012, 101:043904.CrossRef 14.

5 μL double-distilled water (ddH2O). The protocol followed for each qPCR was as follows: hot start

at 95°C for 10 s, followed by 45 cycles at 95°C for 5 s, 60°C for 20 s. Data were collected and analyzed using Opticon Monitor software V3.1 (BIO-RAD). To normalize the data, primer pairs were designed to amplify the gene glyceraldehyde-3-phosphate dehydrogenase (gapdh) as housekeeping control. Based on the gene classification, 10 genes were selected for the PCR amplification and the specific primer sets that were used are listed in Table 4. www.selleckchem.com/products/mln-4924.html The specificity of each resulting amplicon was validated with its corresponding melting curve. The relative level of expression was calculated by comparing the difference in the threshold cycle number of the gene of interest gene with that of the reference gene. Table 4 Primers used for real-time PCR in this study gene Sequences of primers (5′ to 3′) Amplicon size (bp) cwh TGGTAAATGCCCCATCTAGTC TGF-beta inhibitor 137   GGCTGTAACACCAATAATTTCC   hprk GAAACCCCTGTTGTCATAGTGG 126   CAATTCTCCCGATAGACGACTG

  ss-1616 ACAGGGAATAAGCATCAGCG 119   ATGTAGTTACGCTCCGCCTT   ysirk GCACTTTTATTGCCACGGATT 160   CAGCACCTTGTTGTCTCGGA   gapdh TTGGAAGCTACAGGTTTCTTTG 98   TTACCACCAGGAGCAGTGACA   ss-1955 ATCAGGTTCTAACATTGTTGCG 122   TAACGCCCCCCTCTAACAAG   srt GGTCGACGAAGTGTCATTGC 123   ATACGTCAGCGTCCTCCCAC   nlpa CTGCAACCTGGTCACCAAATAC 129   ACCCCGGAAAAGTTACGTATGA   sdh TAGAAGTCCCTTGTGTCAGACG 134   AGATCCCACTTGGTACATAGCG   ss-1298 TGGATATCGACAGCAAGGAG 156   CATAGTCGCCCAAATAGAGC   trag TCGTGACTTGATGACGGCTG 167   GATAATGCCACCAGCGTTCA   Colony PCR analysis To learn about gene distribution in diverse SS2 isolates with different backgrounds, colony PCR was used. The primers used

to detect the 10 IVI genes were same as the oligonucleotides for qPCR (Table 4). Single SS2 colonies were picked from THA plates, suspended in 50 μL of ddH2O and boiled for 10 min to make DNA lysates. Each was assayed using the appropriate primer sets by PCR. PCR reactions were carried out using Taq polymerase according to the manufacturer’s recommendation (TaKaRa). Acknowledgements This work was Staurosporine ic50 supported by the National Basic Research Program (No. 2006CB504400) from Ministry of Science and Technology of the People’s Republic of China. We appreciate the thoughtful comments of Drs. Huochun Yao, Hongjie Fan, Yongjie Liu, Rongmei Fei, Jianhe Sun, Yaxian Yan, Jianluan Ren, and Yong Yu. We thank Miss Kaicheng Wang for kindly providing rGAPDH for this study, and Dr. Yuling Ma and Mr. Piren Chen for their assistance in sera collection. We also thank Dr. H.E. Smith for providing the SS2 T15 Strain. We are extremely grateful to Dr. Xiuguo Hua for providing SPF minipiglets. Electronic supplementary material Additional file 1: Swine convalescent sera preparation. The data provided represent the preparation of swine convalescent sera. * Time-point of antibody check. ‡ Sacrificed and serum collection.

J Clin Microbiol 2003, 41:1801–1804.PubMedCrossRef 48. Francois P, Huyghe A, Charbonnier Y, Bento M, Herzig S, Topolski I, Fleury B, Lew D, Vaudaux P, Harbarth S, van Leeuwen W, van Belkum A, Blanc DS, Pittet D, Schrenzel J: Use of an automated multiple-locus, variable-number tandem repeat-based method for rapid and high-throughput genotyping of Staphylococcus aureus isolates. J Clin Microbiol 2005, 43:3346–3355.PubMedCrossRef 49. Hardy KJ, Ussery DW, Oppenheim BA, Hawkey PM: Distribution and characterization of staphylococcal interspersed repeat units (SIRUs) and potential use for strain differentiation. Microbiology Selumetinib 2004,

150:4045–4052.PubMedCrossRef 50. Brochet M, Couvé E, Zouine M, Vallaeys T, Rusniok Selleck CP673451 C, Lamy M-C, Buchrieser C, Trieu-Cuot P, Kunst F, Poyart C, Glaser P: Genomic diversity and evolution within the species Streptococcus agalactiae . Microbes Infect 2006, 8:1227–1243.PubMedCrossRef 51. Tettelin H, et al.: Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae : implications for the microbial “”pan-genome”". Proc Natl Acad Sci USA 2005, 102:13950–13955.PubMedCrossRef 52. Dauchy FA, Degrange S, Charron A, Dupon M, Xin Y, Bebear C, Maugein J: Variable-number tandem-repeat markers for typing Mycobacterium intracellulare strains isolated in

humans. BMC Microbiol 2010, 10:93.PubMedCrossRef 53. Gravekamp C, Kasper DL, Michel JL, Kling DE, Carey V, Madoff LC: Immunogenicity and protective efficacy of the alpha C protein of group B streptococci are inversely related to the

number of repeats. Infect Immun 1997, 65:5216–5221.PubMed 54. Madoff LC, Michel JL, Gong EW, Kling DE, Kasper DL: Group B streptococci escape host immunity by deletion of tandem repeat elements of Bumetanide the alpha C protein. Proc Natl Acad Sci USA 1996, 93:4131–4136.PubMedCrossRef 55. Schubert A, Zakikhany K, Schreiner M, Frank R, Spellerberg B, Eikmanns BJ, Reinscheid DJ: A fibrinogen receptor from group B Streptococcus interacts with fibrinogen by repetitive units with novel ligand binding sites. Mol Microbiol 2002, 46:557–569.PubMedCrossRef 56. Rosenau A, Martins K, Amor S, Gannier F, Lanotte P, van der Mee-Marquet N, Mereghetti L, Quentin R: Evaluation of the ability of Streptococcus agalactiae strains isolated from genital and neonatal specimens to bind to human fibrinogen and correlation with characteristics of the fbsA and fbsB genes. Infect Immun 2007, 75:1310–1317.PubMedCrossRef Authors’ contributions EH and GB carried out the molecular genetic studies by MLST and MLVA. CP performed BioNumerics analysis of data and helped to draft the manuscript. MFL and ASD contributed to MLST analysis. AR and RQ participated in the design of the study. LM participated in the design of the study and helped to draft the manuscript. EH and PL conceived the study and draft the manuscript. All authors read and approved the final manuscript.

As a consequence, the spinach structure shows a single 25 residue-long helix rather than the two helices (2a and 2b) observed in CyanoQ. In addition, PsbQ contains a much longer N-terminal sequence, which might be important for binding to PSII (Kuwabara et al. 1986). All three crystallised proteins differ in their isoelectric points as calculated by Protparam (Gasteiger et al. 2005) with pI values of 4.5 for T. elongatus CyanoQ, 5.6 for Synechocystis CyanoQ and 9.25 for spinach PsbQ. This

is reflected in their surface charge distribution (Fig. 5). Both CyanoQ proteins show 4EGI-1 molecular weight only a small patch of positively charged surface around T. elongatus Arg109, whereas the equivalent region of the PsbQ protein contains a large patch of lysine residues thought to be involved in binding to PSII (Meades et al. 2005) (Fig. 5, top). Fig. 5 Solvent accessible surface charges of CyanoQ from T. elongatus (3ZSU), Synechocystis (3LS0) and spinach PsbQ (1VYK and 1NZE). Colour range spans from -5 (red) to 5 (blue) kT/e. Differences between the two spinach structures result from the fact that fewer residues could be fitted in 1NZE. Arrows point at Cα of selected residues. Arg109 is resolved in dual conformation Significant differences in surface charge are also observed on the opposite faces of PsbQ and CyanoQ (Fig. 5): PsbQ is relatively uncharged whereas CyanoQ is negatively charged (Fig. 5, bottom row).

Given the differences in composition of the extrinsic PSII subunits in cyanobacteria and plants, this face of the protein may be involved in interactions Selleck Dinaciclib with these subunits or with assembly factors or possibly other protein components in the thylakoid membrane. Comparison of zinc-binding sites Zinc ions have been shown to bind to plant PsbQ (Calderone 4��8C et al. 2003; Balsera

et al. 2005) and CyanoQ from Synechocystis (Jackson et al. 2010), although the binding sites are not conserved (Fig. S7). Zinc has also been shown to bind to plant PsbP (Kopecky et al. 2012) and CyanoP from T. elongatus (Michoux et al. 2010) and Synechocystis (Jackson et al. 2012). The physiological relevance of these metal binding sites is currently unknown. In Synechocystis CyanoQ two zinc ions are coordinated by six amino-acid residues (Fig. 3 and Fig. S7). Despite the fact that five out of the six corresponding positions are occupied by potential metal ligands in T. elongatus CyanoQ, no zinc cations are present in the crystal structure. Unlike Synechocystis CyanoQ, where it was possible to obtain both zinc-bound and metal-free structures, our attempts to crystallise T. elongatus CyanoQ with zinc failed. Although there were no bound Zn2+ ions in our structure, we were able to fit a sulphate ion into the electron density. This anion is coordinated by three consecutive residues, Ser126ValThr128, found at the beginning of helix 4, at the apex of the protein.