Lys05 induces lysosomal membrane permeabilization and
increases radiosensitivity in glioblastoma

Wei Zhou1 | Yulian Guo2 | Xin Zhang2 | Zheng Jiang2
Department of Radiation Oncology, Qilu
Hospital, Shandong University, Jinan,
Shandong, China
Department of Neurosurgery, Qilu
Hospital of Shandong University and
Brain Science Research Institute,
Shandong University, Jinan, China
Correspondence
Zheng Jiang, MD, PhD, Department of
Neurosurgery, Qilu Hospital of Shandong
University and Brain Science Research
Institute, Shandong University, 250012
Jinan, China.
Email: [email protected]
Funding information
Natural Science Foundation of Shandong
Province, Grant/Award Number:
ZR2014HM074

Abstract
Glioblastoma (GBM) is one of the most malignant primary brain tumors and its
prognosis is very poor. Lysosome‐dependent cell death is mainly caused by
lysosomal membrane permeabilization (LMP), a process in which the lysosome
loses its membrane integrity and lysosomal contents are released into the
cytosol. Lysosomotropic agent, a kind of compound that selectively accumulates
in the lysosomes, is one of the most important inducers of LMP. As a newly‐
synthetic lysosomotropic agent, Lys05 showed efficient autophagy inhibiting
and antitumor effect. But its mechanisms are not well illustrated. Here, we
studied whether Lys05 has antiglioma activity. We found that Lys05 decreased
cell viability and reduced cell growth of glioma U251 and LN229 cells. After
Lys05 treatment, autophagic flux is inhibited and lysosome function is
impaired. We also found that Lys05 caused LMP and mitochondrial
depolarization. Finally, Lys05 increased radiosensitivity in an LMP‐dependent
manner. For the first time, our findings indicate that LMP contributes to
radiosensitivity in GBM cells. Therefore, LMP inducer, Lys05 might be a
promising compound in the treatment of GBM cells.

KEYWORDS
autophagy, glioblastoma, Lys05, lysosomal membrane permeabilization, radiosensitivity, TFEB

1 | INTRODUCTION
As one of the most malignant tumors in the brain,
glioblastoma (GBM) accounts for more than 50% of all
adult gliomas and patients with GBM have a poor
prognosis, despite a comprehensive treatment including
excision, chemo‐ and radio‐therapy.1 Among the factors
that lead to treatment failure, resistance to antitumor
therapies is one of the most important.
Autophagy is a dynamic process in which metabolic
wastes, toxic protein aggregates, nonfunctional orga￾nelles, intracellular pathogens are engulfed into a
double‐membrane vesicle and then sent to lysosome
for degradation as well as recycling.2 As a result,
autophagy is recognized as a survival advantage for
cells.3 More and more studies showed that in
malignant tumors, autophagy and lysosomal activity
is elevated in advanced cancers, which will contribute
to tumorigenesis, tumor development and increase the
resistance to adverse factors, such as low oxygen, high
level of reactive oxygen species (ROS) and antitumor
therapies.4,5 When autophagy is inhibited, cell death
will be induced and tumor cells are more sensitive to
antitumor reagents.3
Because of its roles in the degradation of dysfunc￾tional organelles and metabolic debris, our previous
understanding of lysosome is only limited to waste bag.
However, our knowledge of lysosome has improved a
lot during the past decade. The lysosome is reported to
be involved in many cellular processes and is regarded
as regulators of cell homeostasis. Cell death can also be
induced in a lysosome‐dependent way, and one of the
most studied is lysosomal membrane permeabilization
(LMP).6 LMP is a process in which an impaired
lysosomal membrane induces a cascade of regulated
cell death mediated by the release of specific lysosomal
enzymes into the cytosol. Among them, cathepsin B
and D are the main active proteases after LMP.7-9 And
lysosomes are also involved in chemo‐ and radio‐
resistance.5,10
Autophagy inhibitors, especially lysosome inhibi￾tors, such as chloroquine (CQ) and hydroxychloro￾quine, have shown efficient antitumor effect in a variety
of tumor types.11,12 Clinical trials have also been carried
out to test their antitumor effect and the results are
promising.13-15 However, due to their serious side
effects, patients with malignant tumors could not
tolerate their major side effect, which hinders their
further use in the clinic.
Lys05, an analogue of CQ, has been proven to have
much stronger autophagy inhibiting effect and the
previous study showed that Lys05 had efficient single‐
agent antitumor activity.16 Besides, Lys05 showed
promising combined treatment effect on chronic mye￾loid leukemia.17 But its antitumor effect is not fully
understood. Here, we tested whether Lys05 has anti￾glioma effect. Our research showed that Lys05 de￾creased cell viability, inhibited cell proliferation and
caused cell cycle arrest in vitro. We also found that
Lys05 triggered LMP and increased radiosensitivity in
glioma cells. Our results indicate that Lys05 is a
promising antiglioma compound.

2 | MATERIALS AND METHODS

2.1 | Cell culture
U251 and LN229, two human glioma cell lines, were
purchased from the cell bank of the Chinese Academy of
Sciences (Shanghai, China). Cells were cultured in
Dulbecco’s modified Eagle’s medium (DMEM; Thermo
Fisher Scientific, Waltham, MA) containing 10% fetal
bovine serum (FBS; Thermo Fisher Scientific), gluta￾mine (4 mM), penicillin (10 U/mL), and streptomycin
(100 mg/mL).

2.2 | Cell viability assay
The cell viability was determined by Cell Counting Kit‐8
(CCK‐8) assays. GBM cells were plated into 96‐well
plates. After attachment and different doses of Lys05
treatment for 24 hours, 10 µL of CCK‐8 reagents were
added into each well. After incubation for 1 hour, plates
were put on a microplate reader (Bio‐Rad Laboratories,
Richmond, CA) to test the absorbance.

2.3 | EdU proliferation assay
EdU proliferation assay was done by the EdU incorpora￾tion assay kit (RiboBio, Guangzhou, China). U251 and
LN229 cells were seeded into 24‐well plates. After
attachment, cells were treated with 2.5 μM of Lys05 or
dimethyl sulfoxide (DMSO) for 24 hours, and stained
with EdU according to the manufacturer’s instructions.
Cells were observed under fluorescence microscopy
(Leica DMi8; Leica Microsystems, Wetzlar, Germany).

2.4 | Cell cycle analysis
After treatment with 2.5 μM Lys05 or DMSO for 24 hours,
cells were trypsined into single cells and fixed with 70%
ethanol at 4°C overnight. Then cells were washed with
phosphate‐buffered saline (PBS), and stained in propi￾dium iodide (PI) with RNase (Becton Dickinson, San
Diego, CA) for 15 minutes. A C6 flow cytometer (BD
Biosciences, San Jose, CA) was used to test cell cycle.

2.5 | Western blot analysis
After being seeded into six‐well plates and incubation
overnight, U251 and LN229 cells were treated with
DMSO, 2.5 μM, 5 μM Lys05, 2.5 μM rapamycin, or
100 nM bafilomycin A1 for 24 hours. Protein lysates
(20 µg) were prepared with radioimmunoprecipitation
assay buffer (Beyotime, China) and its concentrations
were determined by BCA assay (Beyotime). Then protein
lysates were separated by polyacrylamide gel electro￾phoresis, and transferred to polyvinylidene difluoride
membranes. Membranes were blocked with 5% skimmed
milk and subsequently incubated with primary and
indicated secondary antibodies. Membranes were incu￾bated with reagents from Chemiluminescent Reagents
Kit (Millipore, Billerica, MA) and visualized with the
ChemiDoc XRS+ (Bio‐Rad, Hercules, CA). Immunoblot
analysis was performed by using Image Lab 3.0 software
(Bio‐Rad) according to the manufacturer’s instructions.
Primary antibodies LC3B, P62 and glyceraldehyde
3‐phosphate dehydrogenase (GAPDH) were purchased
from Cell Signaling Technology (Danvers, MA). Second￾ary antibodies conjugated to horseradish peroxidase were
purchased from Sigma‐Aldrich (St. Louis, MO).

2.6 | Autophagic flux measurement
An autophagy Tandem Sensor RFP‐GFP‐LC3B Kit was
used to study the autophagic flux according to the
manufacturer’s instructions. Briefly, cells were incubated
with the RFP‐GFP‐LC3B reagent. Forty‐eight hours later,
cells were cultured on coverslips (37°C, 5% CO2). After
2 | ZHOU ET AL.
treatment with DMSO or 2.5 μM Lys05 for 24 hours, cells
were fixed with 4% paraformaldehyde and antifade
mounting medium was added. Then images were
captured with a Leica TCS SP5 Confocal Laser Scanning
Microscope (Leica Microsystems).

2.7 | Transmission electron microscopy
Transmission electron microscopy was done according to
our previous study.3 Briefly, cells were fixed with 4%
glutaraldehyde, and post‐fixed with 1% OsO4 in 0.1 M
cacodylate buffer containing 0.1% CaCl2. Cells were stained
with 1% Millipore‐filtered uranyl acetate, dehydrated in
graded alcohol series and embedded in epoxy resin.
Ultrathin sections were cut by a Leica Ultracut Microtome.
Sections were stained with uranyl acetate and lead citrate.
Images were obtained using a JEM‐1200EX II electron
microscope (JEOL, Tokyo, Japan).

2.8 | LysoTracker staining
Treated with DMSO or 2.5 μM Lys05 for 24 hours, U251
and LN229 cells were washed with fresh DMEM, and
incubated with 66 nM LysoTracker Red for 30 minutes.
Nuclei were stained with 4′,6‐diamidino‐2‐phenylindole
(DAPI; Thermo Fisher Scientific), and live cells were
observed using a Leica DMi8 fluorescence microscope.

2.9 | Lysosomal membrane stability
Lysosomal membrane stability was tested using acridine
orange (AO; Sigma‐Aldrich). GBM cells were first
incubated with AO solution (5 μg/mL) in complete
medium for 15 minutes at 37°C. Then cells were exposed
to DMSO or 2.5 μM Lys05 for 60 minutes. Images were
taken with a Leica TCS SP5 Confocal Laser Scanning
Microscope.
EGFP‐galectin‐3 (Obio, Shanghai, China) transient
transfection was performed by using Lipofectamine 2000
reagent (Thermo Fisher Scientific). U251 and LN229 cells
were seeded on coverslips. After treatment with DMSO or
2.5 μM Lys05 for 24 hours, GBM cells were fixed with 4%
paraformaldehyde and antifade mounting medium was
added. Then images were taken by a Leica SP5 Confocal
Microscope.

2.10 | Measurement of mitochondrial
membrane potential
After treatment with DMSO or 2.5 μM Lys05 for
60 minutes, GBM cells were loaded with tetramethylrho￾damine methyl ester (JC‐1) for 30 minutes. Images were
taken by using a Leica DMi8 fluorescence microscopy.
Cells were also analyzed by flow cytometry in a C6 flow
cytometer (BD Biosciences).

2.11 | Immunofluorescence
Immunofluorescence detection of cytochrome C was
performed to monitor mitochondria‐dependent cell
death. U251 and LN229 cells cultured on coverslips were
treated with DMSO or Lys05 (2.5 μM). After 24 hours,
cells were washed with PBS, fixed with 4% paraformal￾dehyde, permeabilized with 0.2% Triton X‐100, blocked
with 3% bovine serum albumin, and incubated overnight
at 4°C with cytochrome C and Tom20 antibody (Cell
Signaling Technology). On the second day, cells were
incubated with goat anti‐rabbit secondary antibody
(Alexa Fluor 488) and goat anti‐mouse secondary anti￾body (Alexa Fluor 594; Abcam, Cambridge, UK) for
1 hour. Nuclei were stained with DAPI (Sigma‐Aldrich).
Immunofluorescence of phospho‐Histone H2A.X
(Ser139, also called γ‐H2AX) was carried out to detect
DNA double‐strand breaks (DSBs). Cells cultured on
coverslips were treated with DMSO or Lys05 (2.5 μM) for
24 hours before receiving one dose of 4 Gy at a dose rate of
1.8 Gy/min in a linear accelerator (Primus Hi; Siemens
Medical Instruments, Berlin, Germany). After irradiation
treatment for 24 hours, cells were fixed with 4% paraf￾ormaldehyde. γ‐H2AX antibody and goat anti‐rabbit
secondary antibody (Alexa Fluor 594; Abcam) were used.
Images were taken by using a Leica TCS SP5 Confocal
Laser Scanning Microscope.

2.12 | Quantitative real‐time
polymerase chain reaction
After related treatment, total RNA was extracted from
GBM cells using RNAiso (Takara, Japan) according to
the manufacturer’s protocol. The PrimeScript RT
Reagent Kit (Takara) was used to conduct reverse
transcription. Quantitative real‐time polymerase chain
reaction (qRT‐PCR) was performed with SYBR premix
Ex Taq (Takara) on the CFX96 Real Time PCR Detection
System (Roche 480II, Berlin, Germany). GAPDH
messenger RNA (mRNA) was used to normalize mRNA
expression. The sequences of the primers used are
shown in Table 1.

2.13 | Cell transfection
Cells were transfected with small interfering RNA
(siRNA) by using Lipofectamine 2000 (Invitrogen). The
final concentration of siRNAs was 20 nM. siRNAs for
TFEB and nontargeting siRNA controls were purchased
from Qiagen (Hilden, Germany).
ZHOU ET AL. | 3

2.14 | Lactate dehydrogenase assay
A Cytotoxicity Detection Kit (Roche Applied Science)
was used to detect the cytotoxic effect by measuring the
release of lactate dehydrogenase (LDH) from the cytosol
according to the manufacturer’s instructions. Briefly,
after indicated treatment and incubation with a lysis
buffer (2% Triton X‐100), cell lysate was centrifuged and
the supernatants were collected to measure total cellular
LDH. The amount of released LDH from each group was
measured at 490 nm by a microplate reader.

2.15 | Annexin V apoptosis assay
The FITC‐annexin V/Propidium Iodide Assay Kit (BD
Biosciences) was used to evaluate apoptosis. U251 and
LN229 cells were divided into four treatment groups:
DMSO treatment for 48 hours; 2.5 μM Lys05 treatment
for 48 hours; DMSO treatment for 48 hours plus 4 Gy
irradiation treatment for 24 hours; 2.5 μM Lys05 treat￾ment for 48 hours plus 4 Gy irradiation treatment for
24 hours. Then cells were collected, washed in PBS,
resuspended in the reagents containing annexin V‐FITC
and PI and incubated for 15 minutes. Cells were analyzed
by flow cytometry in a C6 flow cytometer (BD
Biosciences).

2.16 | Cathepsin B activity
Cathepsin B activity was tested using a Fluorometric Kit
(Abcam) according to our previous study.3 After treat￾ment with or without 4 Gy irradiation for 24 hours, U251
and LN229 cells were lysed with lysis buffer and
supernatants were incubated with substrate of cathepsin
B (Ac‐RR‐AFC) at 37°C for 1.5 hours. Then samples were
measured in a fluorescent microplate reader at excita￾tion/emission wavelength = 400/505 nm. After subtract￾ing the background control (lysis buffer) from sample
readings, the activity of cathepsin B was determined by
comparing results from irradiated cells with the level
from controls.

2.17 | Statistical analysis
Unpaired t tests were performed by using the Graph￾Pad Prism software program (version 6.07, La Jolla, CA).
Results were presented as the mean ± SE. P < .05 were
considered statistically significant.

3 | RESULTS

3.1 | Lys05 decreased the cell viability,
cell proliferation, and caused cell cycle
arrest in GBM cells
To study whether Lys05 had antitumor effect in vitro, we
first tested the cell viability in GBM cells U251 and LN229
after different doses of Lys05 treatment. We found that
after Lys05 treatment, cell viability of GBM cells
decreased in a dose‐dependent manner (Figure 1A).
The IC50 for U251 and LN229 is 9.1 and 6.0 μM,
respectively (Figure 1A, black arrows). To determine
whether cell proliferation of GBM cells is affected, an
EdU test kit was used. Briefly, in proliferating cells, EdU
was incorporated into the cells and it could be detected
through a catalyzed reaction with a fluorescently labeled
probe. As a result, proliferating cells can be directly
monitored and viewed under a fluorescent microscope.
Results showed that after 2.5 μM Lys05 treatment for
24 hours, EdU positive cells decreased significantly, from
36.67 ± 5.044 for U251, 41.67 ± 3.480 for LN229, to
13.33 ± 2.333 for U251, 15.33 ± 2.028 for LN229, com￾pared with DMSO treatment (Figure 1B,C).
As a result of aberrant activity of various cell cycle
proteins, cancer is characterized by persistent tumor cell
proliferation. Therefore, compounds that cause cell cycle
arrest are promising in anticancer management.18 We
then tested whether Lys05 could affect cell cycle in GBM
cells. With PI staining and flow cytometry, we found
that Lys05 caused cell cycle arrested in G0‐G1 phases
(Figure 1D,E). All these data showed that Lys05 had an
efficient antitumor effect in GBM cells in vitro.
TABLE 1 Primers for quantitative real‐time polymerase chain reaction
Gene name Forward primer Reserve primer
CTSA CAGGCTTTGGTCTTCTCTCCA TCACGCATTCCAGGTCTTTG
CTSB AGTGGAGAATGGCACACCCTA AAGAAGCCATTGTCACCCCA
CTSD AACTGCTGGACATCGCTTGCT CATTCTTCACGTAGGTGCTGGA
CTSF ACAGAGGAGGAGTTCCGCACTA GCTTGCTTCATCTTGTTGCCA
CTSS GGGATCTCTGGAAGAAAACCC TTCGGAGACTGTCGGGGAAT
TFEB CCAGAAGCGAGAGCTCACAGAT TGTGATTGTCTTTCTTCTGCCG
GAPDH TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG
4 | ZHOU ET AL.

3.2 | Lys05 inhibited autophagy and
impaired lysosome functions in GBM cells
Previous study recognized Lys05 as a strong autophagy
inhibitor. Here we tried to study its effect on autophagy
in GBM cells. First, the protein levels of LC3B and P62,
two important markers involved in autophagy, were
tested by Western blot analysis. LC3B has two subtypes,
LC3B‐I and LC3B‐II. In the process of autophagy,
LC3B‐I is transformed into LC3B‐II. Results showed
that Lys05 treatment obviously increased the expression
of LC3B‐II (Figure 2A), which indicated that Lys05
treatment affected autophagy. We also found that the
protein level of P62, a long‐lived protein which will be
degraded in autophagy, increased after Lys05 treatment
(Figure 2A), which suggested that Lys05 might inhibit
autophagy.
To study whether Lys05 interfered with the autop￾hagic flux of GBM cells, a commercial autophagy
Tandem Sensor RFP‐GFP‐LC3B Kit was used. In this
kit, green fluorescent protein (GFP) is more sensitive to
the acid environment. In the neutral autophagosome,
both GFP and red fluorescent protein (RFP) will show
their fluorescence. If the autophagic flux is smooth, the
autophagosome will fuse with the lysosome to form
the acidic autolysosome, in which only red fluorescence
(RFP) can be detected. Results showed that in the
control group, few dots of red or green can be found
(Figure 2B,C). While in Lys05 treatment group, red and
green dots increased significantly (Figure 2B,C). And
there was no statistical difference between the number
of red and green dots (Figure 2C and Figure S1), which
suggested that the autophagic flux is impaired after
Lys05 treatment in GBM cells. But there are two
explanations for these results. One is that Lys05 inhibits
the fusion of the autophagosome with the lysosome.
Another explanation is that autolysosome is formed, but
its acidity is impaired. To find out the mechanisms, we
used LysoTracker Red, an acid‐sensitive probe, to stain

FIGURE 1 Lys05 decreased the cell viability, inhibited cell proliferation and caused cell cycle arrest in GBM cells. A, After treatment
with different doses of Lys05 for 24 hours, cell viability was tested by CCK‐8 assays. Lys05 decreased cell viability in GBM cell lines U251 and
LN229 in a dose‐dependent manner. IC50 for U251 and LN229 is 9.1 and 6.0 μM, respectively (black arrows). B, Representative images of
EdU test in GBM cells treated with DMSO or 2.5 μM Lys05 for 24 hours. C, Quantification of EdU positive cells counted from five random
fields in each treatment group. D, Cell cycle analysis of GBM cells treated with DMSO or 2.5 μM Lys05 for 24 hours. E, Quantification of cells
in G1, S, and G2/M phases. *P < .05; **P < .01. CCK‐8, Cell Counting Kit‐8; DMSO, dimethyl sulfoxide; GBM, glioblastoma
ZHOU ET AL. | 5

FIGURE 2 Lys05 inhibited autophagy and impaired lysosome function in GBM cells. A, Western blot analysis of LC3B and P62 in U251
and LN229 cells treated with DMSO, 2.5 and 5 μM Lys05 for 24 hours. GAPDH was used as a loading control. The numbers below the blots
correspond to relative quantification by densitometry compared with the reference point (set as 1.0). B, RFP‐GFP‐LC3 construct was
transfected into GBM cell lines to study the influence of autophagic flux after DMSO or 2.5 μM Lys05 treatment. C, Quantification of red and
green dots of (B). D, LysoTracker Red was used to stain lysosome after DMSO or 2.5 μM Lys05 treatment for 24 hours. In Lys05 treatment
group, the fluorescent intensity decreased. E, Transmission electron microscopy showed the ultrastructure of U251 and LN229 cells treated
with DMSO or 2.5 μM Lys05. Many big vesicles in which several undigested particles accumulated could be detected in Lys05‐treated cells
(black arrows). F, Quantification of accumulated vesicles in (E). G, Western blot analysis of LC3B, P62, and GAPDH after treatment with
DMSO, 2.5 μM Lys05, 2.5 μM rapamycin or 100 nM bafilomycin A1 for 24 hours. **P < .01. DMSO, dimethyl sulfoxide; GAPDH,
glyceraldehyde 3‐phosphate dehydrogenase; GBM, glioblastoma
6 | ZHOU ET AL.
GBM cells treated with or without Lys05.
Results showed that in Lys05 treatment group, the red
fluorescence decreased a lot (Figure 2D), which
indicated that Lys05 impaired the function of lysosome.
With the transmission electron microscope, we
also found that in Lys05 treatment group, there are
many big vesicles in which several undigested particles
accumulated (Figure 2E,F, black arrows). We also used
rapamycin, an autophagy inducer, and bafilomycin A1,
an autophagy inhibitor as positive controls. Western
blot analysis showed that Lys05 had the same effect on
protein levels of LC3B and P62 as bafilomycin A1
(Figure 2G). All these data suggested that Lys05
inhibited autophagy by impairing lysosomal function.
3.3 | Lys05‐induced LMP in GBM cells
Lys05 was recognized as a lysosomotropic agent. Lysoso￾motropic agent is a kind of compound that selectively
accumulates in lysosome. Previous study showed that
lysosomotropic agent is a major inducer of LMP. LMP is a
process in which destabilization of the lysosomal
membrane allows leaking of lysosomal contents into
the cytoplasm, resulting in this cell death modality. As
we have found that Lys05 impaired the function of
lysosomes, we tried to study whether Lys05 could induce
LMP in GBM cells.
First, we used AO to stain GBM cells treated with or
without Lys05. AO is a lysosomotropic weak base and

FIGURE 3 Lys05‐induced lysosomal membrane permeabilization in GBM cells. A, Acridine orange staining of GBM cell lines U251 and
LN229 after treatment with DMSO or 2.5 μM Lys05 for 24 hours. B, EGFP‐Gal3 construct was used to study LMP in GBM cells treated with
DMSO, 5 μM siramesine and 2.5 μM Lys05 for 24 hours. LMP‐inducer siramesine (5 μM) was used as a positive control. Green dots could be
seen in siramesine and Lys05‐treated cells. C, JC‐1 staining of GBM cells treated with DMSO or 2.5 μM Lys05 for 24 hours. Lys05‐induced
mitochondrial depolarization. D, Flow cytometry of JC‐1 staining. E, Immunofluorescence of Tom20 and cytochrome C in U251 and LN229
cells treated with DMSO or 2.5 μM Lys05 for 24 hours. cytochrome C was evenly distributed in the cytoplasm in Lys05‐treated cells. F, LDH
assay showed that Lys05‐induced cytotoxicity could be interfered by CA‐074 Me, a specific inhibitor of cathepsin B. **P < .01; ***P < .001.
DMSO, dimethyl sulfoxide; GBM, glioblastoma; LDH, lactate dehydrogenase; LMP, lysosomal membrane permeabilization
ZHOU ET AL. | 7
will accumulate in acidic compartments. The concentra￾tion of AO is high in intact lysosomes, and emits red
fluorescence. If the lysosomal membrane is impaired, AO
concentrations are low, and emits green fluorescence.
Results showed that after Lys05 treatment, red fluores￾cence almost disappeared and only green fluorescence
was detected (Figure 3A).
To verify this further, we examined the integrity of
lysosome by using GFP‐fused Galectin 3 (EGFP‐Gal3),
which binds to β‐galactoside on luminal glycoproteins
of endosomes or lysosomes with ruptured mem￾branes.19 In DMSO‐treated GBM cells, EGFP‐Gal3 was
distributed evenly in the cytoplasm; however, EGFP‐
Galectin‐3 formed fluorescent dots in LMP‐inducer,
siramesine treatment group. In Lys05‐treated GBM
cells, green dots could also be induced (Figure 3B and
Figure S2). All these data suggested that Lys05 led to
LMP in GBM cells.
Previous study showed that LMP could induce
mitochondria‐dependent cell death.6 We used JC‐1
staining to test whether Lys05 has effect on mitochon￾dria. Results showed that Lys05 caused depolarization
of mitochondria (Figure 3C,D). Double immunofluor￾escence of Tom20, one of the membrane proteins of

FIGURE 4 Lys05 increased radiosensitivity in GBM cells in a TFEB‐dependent way. A, Apoptosis analysis showed that Lys05
combining with irradiation caused more cell apoptosis compared with irradiation treatment alone. B, PCR of cathepsin A, B, D, F, S, and
TFEB in GBM cells after treatment with irradiation, siTFEB, irradiation combined siTFEB. C, A fluorometric kit was used to test the
cathepsin B activity of GBM cells treated with or without 4 Gy irradiation. Results showed that irradiation increased the activity of cathepsin
B significantly, compared with non‐irradiation group. D, LDH release assay showed that siTFEB decreased LDH release caused by
irradiation combined Lys05. E, Immunofluorescence of γ‐H2AX in GBM cells treated with irradiation, Lys05, irradiation combined with
Lys05. F, Quantification of γ‐H2AX‐positive cells in (E). IR indicated irradiation. *P < .05; **P < .01; ***P < .001; ****P < .0001. GBM,
glioblastoma; LDH, lactate dehydrogenase; TFEB, transcription factor EB
8 | ZHOU ET AL.
mitochondria, and cytochrome C showed that Lys05
treatment induced cytochrome C releasing into
cytoplasm, which indicated that Lys05 might induce
cell death in a mitochondria‐dependent way (Figure
3E). To find out Lys05‐induced cytotoxic effect was
LMP‐dependent, more experiments were carried out.
First, we tested cytotoxicity by LDH assay and found
that Lys05 induced more LDH release than control
group (Figure 3F). CA‐074 Me, a specific cathepsin B
inhibitor was used to inhibit cathepsin B, one important
lysosomal cathepsin involved in LMP‐dependent cell
death. Results showed that CA‐074 Me decreased
Lys05‐induced cytotoxicity, which supported that
Lys05 caused cell death in an LMP‐dependent way
(Figure 3F).

3.4 | Lys05 increased radiosensitivity in
GBM cells in a TFEB‐dependent way
Previous studies found that irradiation increased the
expression of several lysosomal cathepsins, including
cathepsin B, L, and S.20-22 Considering LMP’s role in
inducing cathepsin‐dependent cell death, we assumed
that LMP inducer, Lys05 has a radiosensitive effect on
GBM cells. To verify our hypothesis, U251 and LN229
cells were divided into four treatment groups: DMSO
treatment group; Lys05 treatment group; irradiation
treatment group; Lys05 plus irradiation treatment group.
Apoptosis was tested in these four groups. Results
showed that cell apoptosis increased obviously in Lys05
combining irradiation treatment group (Figure 4A and
Figure S3).
The transcription factor EB (TFEB) has recently been
identified as one of the key regulators of lysosomal
biogenesis. A previous study also reported that after
irradiation treatment, the expression of TFEB increased
significantly.23 As a result, we assumed that irradiation
might increase the lysosomal function in a TFEB‐
dependent manner. Then we used qRT‐PCR to test the
expression of cathepsin A, B, D, F, S, and TFEB in GBM
cells treated with or without 4 Gy irradiation. Results
showed that irradiation increased the expressions of
TFEB and cathepsin A, B, D, F, and S (Figure 4B). Then
we knocked down TFEB by using siRNA (the knocking
down efficiency was verified by qRT‐PCR, Figure 4B)
and qRT‐PCR revealed that the expressions of cathepsin
A, B, D, F, and S also decreased (Figure 4B). When
combined with irradiation, the expressions of cathepsin
A, B, D, F, and S did not increase obviously compared
with irradiation treatment alone (Figure 4B). We also
tested the activity of cathepsin B by using a fluorometric
kit. Results showed that irradiation increased the
activity of cathepsin B significantly (Figure 4C).
To further certify Lys05‐induced radiosensitization is
TFEB‐dependent, we used siTFEB and found that in
TFEB knock‐out group, irradiation combined siTFEB
induced less LDH release compared to control group
(Figure 4D).
Irradiation kills cancer cells mainly by causing DNA
damage.3 Among many types of DNA damage, DSBs are
one of the most lethal and γ‐H2AX is a gold standard to
detect the occurrence of DSBs. With immunofluorescence
assay, we found that combining Lys05 with irradiation
led to more DSBs in GBM cells (Figure 4E,F) compared
with Lys05 or irradiation treatment alone. All these
data suggested that Lys05‐induced radiosensitivity in a
TFEB‐dependent way.

4 | DISCUSSION
In the lysosomal lumen, there are more than 50 acid
hydrolases.24 Recent studies found that the functions
of these acid hydrolases are not only limited to late
stage autophagy, but also including regulating cell
homeostasis.25 The role of lysosome in the tumorigen￾esis and tumor development has been paid more and
more attention to26 and many lysosomal hydrolases are
reported to be highly upregulated in various cancers.27
Downregulating these hydrolases will inhibit cancer
cell growth and decrease chemo‐ and radio‐resistance.27
As a result, lysosome is a promising target in the
treatment of tumors.
Lysosome is also involved in regulating cell death. One
of the most studied mechanisms is LMP.6 In the process
of LMP, lysosomal membrane integrity is lost and luminal
contents are released into the cytoplasm. Acid hydrolases,
especially cathepsins cause damage to organelles, and cell
death, such as apoptosis, pyroptosis, or necrosis will be
induced.28 Many factors can contribute to LMP, including
ROS, lysosomotropic agents, lipids, and Bcl‐2 family
proteins.29 As one of the newly‐synthetic lysosomotropic
agents, Lys05 is reported to be highly efficient in the
treatment of cancers.16,17,30 In our study, we found that
Lys05 showed efficient antitumor role in GBM cells. First,
FIGURE 5 Schematic diagram shows the underlying
radiosensitive mechanisms of Lys05
ZHOU ET AL. | 9
we found that Lys05 decreased cell viability and cell
proliferation. Cell cycle arrested in G0‐G1 phases may
explain the cell proliferation inhibition of Lys05. As an
autophagy inhibitor, we found that Lys05 impaired the
degradation of autolysosomes, but it did not interfere
the fusion of autophagosome with lysosome. We also
found that Lys05‐induced LMP, which caused mitochon￾dria‐dependent cell death. When cathepsin B is inhibited
by its specific inhibitor, Lys05 caused less cytotoxicity in
GBM cell, which suggested that Lys05‐induced cell
death is LMP dependent. When combing with irradiation,
Lys05 increased radiosensitivity obviously. Further study
demonstrated that LMP contributed to Lys05‐caused
radiosensitization in GBM cells. This is the first study
showing that LMP is involved in radiosensitivity. We also
found that after irradiation treatment, lysosomal function
is enhanced in a TFEB‐dependent manner. TFEB is a
transcription factor that is involved in lysosomal biogen￾esis.31 Previous study found that TFEB was upregulated
after irradiation treatment, which suggested that lysoso￾mal biogenesis was enhanced.23 Besides, many studies
also illustrated that autophagy was upregulated after
irradiation treatment, and the enhancement of lysosomal
function—as the most important part of the late stage of
autophagy—was in consistent with increased autop￾hagy.32-34 By inhibiting TFEB, irradiation‐induced upre￾gulation of lysosomal cathepsins and lysosomal function
is impaired. The underlying mechanism for Lys05‐
induced radiosensitivity is that: by combining irradiation
and Lys05, irradiation‐induced lysosomal biogenesis
caused more lysosomal hydrolysates released into the
cytosol. As a result, more cell death will be induced, and
radiosensitization is achieved (Figure 5). This is supported
by the result that after knocking down TFEB, Lys05‐
induced radiosensitivity is inhibited.
In this study, we found that autophagy inhibitor Lys05
showed an efficient antitumor effect in GBM cells. For
the first time, our study found that LMP inducer
increased radiosensitivity in GBM cells. But more studies
are warranted in other LMP inducers and tumor types.
Our study revealed a potential mechanistic basis and
provided theoretical support for radiosensitization in￾duced by LMP‐inducer, Lys05 in GBM cells.

ACKNOWLEDGMENT
This study was supported by Shandong Province Natural
Science Foundation, China (No. ZR2014HM074).

CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.

AUTHOR CONTRIBUTIONS
WZ and ZJ designed the experiments. WZ, YLG, and XZ
performed the experiments. WZ, YLG, and ZJ analyzed
the data. WZ and ZJ wrote the paper. All authors read
and approved the final manuscript.
ORCID
Zheng Jiang http://orcid.org/0000-0002-0775-6287

REFERENCES
1. Stupp R, Mason WP, van den Bent MJ, et al. Radiotherapy plus
concomitant and adjuvant temozolomide for glioblastoma. N
Engl J Med. 2005;352(10):987‐996. https://doi.org/10.1056/
NEJMoa043330
2. Klionsky DJ, Abdelmohsen K, Abe A, et al. Guidelines for
the use and interpretation of assays for monitoring autophagy
(3rd edition). Autophagy. 2016;12(1):1‐222. https://doi:10.1080/
15548627.2015.1100356
3. Zhang X, Xu R, Zhang C, et al. Trifluoperazine, a novel
autophagy inhibitor, increases radiosensitivity in glioblasto￾ma by impairing homologous recombination. J Exp Clin
Cancer Res. 2017;36(1):118. https://doi.org/10.1186/s13046‐
017‐0588‐z
4. Cheong JK, Zhang F, Chua PJ, Bay BH, Thorburn A, Virshup
DM. Casein kinase 1α‐dependent feedback loop controls
autophagy in RAS‐driven cancers. J Clin Invest. 2015;125(4):
1401‐1418. https://doi.org/10.1172/JCI78018
5. Zhang X, Wang J, Li X, Wang D. Lysosomes contribute to
radioresistance in cancer. Cancer Lett. 2018;439:39‐46. https://
doi.org/10.1016/j.canlet.2018.08.029
6. Wang F, Gómez‐Sintes R, Boya P. Lysosomal membrane
permeabilization and cell death. Traffic. 2018;19(12):918‐931.

https://doi.org/10.1111/tra.12613

7. Aits S, Jaattela M. Lysosomal cell death at a glance. J Cell
Sci. 2013;126(Pt 9):1905‐1912. https://doi.org/10.1242/jcs.
091181
8. Gómez‐Sintes R, Ledesma MD, Boya P. Lysosomal cell death
mechanisms in aging. Ageing Res Rev. 2016;32:150‐168. https://
doi.org/10.1016/j.arr.2016.02.009
9. Boya P. Lysosomal function and dysfunction: mechanism and
disease. Antioxid Redox Signal. 2012;17(5):766‐774. https://doi.
org/10.1089/ars.2011.4405
10. Zhitomirsky B, Assaraf YG. Lysosomes as mediators of drug
resistance in cancer. Drug Resist Updat. 2016;24:23‐33. https://
doi.org/10.1016/j.drup.2015.11.004
11. Levy JMM, Towers CG, Thorburn A. Targeting autophagy in
cancer. Nat Rev Cancer. 2017;17(9):528‐542. https://doi.org/10.
1038/nrc.2017.53
12. Xu R, Ji Z, Xu C, Zhu J. The clinical value of using chloroquine
or hydroxychloroquine as autophagy inhibitors in the treat￾ment of cancers: A systematic review and meta‐analysis.
Medicine. 2018;97(46):e12912. https://doi.org/10.1097/MD.000
0000000012912
13. Rosenfeld MR, Ye X, Supko JG, et al. A phase I/II trial of
hydroxychloroquine in conjunction with radiation therapy and
10 | ZHOU ET AL.
concurrent and adjuvant temozolomide in patients with newly
diagnosed glioblastoma multiforme. Autophagy. 2014;10(8):1359‐
1368. https://doi.org/10.4161/auto.28984
14. Sotelo J, Briceño E, López‐González MA. Adding chloroquine
to conventional treatment for glioblastoma multiforme: a
randomized, double‐blind, placebo‐controlled trial. Ann Intern
Med. 2006;144(5):337‐343.
15. Briceño E, Calderon A, Sotelo J. Institutional experience with
chloroquine as an adjuvant to the therapy for glioblastoma
multiforme. Surg Neurol. 2007;67(4):388‐391. https://doi.org/
10.1016/j.surneu.2006.08.080
16. McAfee Q, Zhang Z, Samanta A, et al. Autophagy inhibitor
Lys05 has single‐agent antitumor activity and reproduces the
phenotype of a genetic autophagy deficiency. Proc Natl Acad
Sci USA. 2012;109(21):8253‐8258. https://doi.org/10.1073/pnas.
1118193109
17. Baquero P, Dawson A, Mukhopadhyay A, et al. Targeting
quiescent leukemic stem cells using second generation
autophagy inhibitors. Leukemia. 2019;33(4):981‐994. https://
doi.org/10.1038/s41375‐018‐0252‐4
18. Otto T, Sicinski P. Cell cycle proteins as promising targets in
cancer therapy. Nat Rev Cancer. 2017;17(2):93‐115. https://doi.
org/10.1038/nrc.2016.138
19. Li Y, Zhang Y, Gan Q, et al. C. elegans‐based screen identifies
lysosome‐damaging alkaloids that induce STAT3‐dependent
lysosomal cell death. Protein Cell. 2018;9(12):1013‐1026. https://
doi.org/10.1007/s13238‐018‐0520‐0
20. Malla RR, Gopinath S, Alapati K, Gorantla B, Gondi CS, Rao JS.
uPAR and cathepsin B inhibition enhanced radiation‐induced
apoptosis in gliomainitiating cells. Neuro Oncol. 2012;14(6):745‐
760. https://doi.org/10.1093/neuonc/nos088
21. Seo HR, Bae S, Lee YS. Radiation‐induced cathepsin S is
involved in radioresistance. Int J Cancer. 2009;124(8):1794‐
1801. https://doi.org/10.1002/ijc.24095
22. Zhang QQ, Wang WJ, Li J, et al. Cathepsin L suppression
increases the radiosensitivity of human glioma U251 cells via
G2/M cell cycle arrest and DNA damage. Acta Pharmacol Sin.
2015;36(9):1113‐1125. https://doi.org/10.1038/aps.2015.36
23. Karagounis IV, Kalamida D, Mitrakas A, et al. Repression of
the autophagic response sensitises lung cancer cells to radiation
and chemotherapy. Br J Cancer. 2016;115(3):312‐321. https://
doi.org/10.1038/bjc.2016.202
24. Lübke T, Lobel P, Sleat DE. Proteomics of the lysosome.
Biochim Biophys Acta. 2009;1793(4):625‐635. https://doi.org/10.
1016/j.bbamcr.2008.09.018
25. Shen HM, Mizushima N. At the end of the autophagic road: an
emerging understanding of lysosomal functions in autophagy.
Trends Biochem Sci. 2014;39(2):61‐71. https://doi.org/10.1016/j.
tibs.2013.12.001
26. Piao S, Amaravadi RK. Targeting the lysosome in cancer. Ann
N Y Acad Sci. 2016;1371(1):45‐54. https://doi.org/10.1111/nyas.
12953
27. Olson OC, Joyce JA. Cysteine cathepsin proteases: regulators of
cancer progression and therapeutic response. Nat Rev Cancer.
2015;15(12):712‐729. https://doi.org/10.1038/nrc4027
28. Repnik U, Hafner Česen M, Turk B. Lysosomal membrane
permeabilization in cell death: concepts and challenges.
Mitochondrion. 2014;19(Pt A):49‐57. https://doi.org/10.1016/j.
mito.2014.06.006
29. Serrano‐Puebla A, Boya P. Lysosomal membrane permeabiliza￾tion in cell death: new evidence and implications for health and
disease. Ann N Y Acad Sci. 2016;1371(1):30‐44. https://doi.org/
10.1111/nyas.12966
30. DeVorkin L, Hattersley M, Kim P, et al. Autophagy inhibition
enhances sunitinib efficacy in clear cell ovarian carcinoma. Mol
Cancer Res. 2017;15(3):250‐258. https://doi.org/10.1158/1541‐
7786.MCR‐16‐0132
31. Sardiello M, Palmieri M, di Ronza A, et al. A gene network
regulating lysosomal biogenesis and function. Science. 2009;
325(5939):473‐477. https://doi.org/10.1126/science.1174447
32. Apel A, Herr I, Schwarz H, Rodemann HP, Mayer A. Blocked
autophagy sensitizes resistant carcinoma cells to radiation
therapy. Cancer Res. 2008;68(5):1485‐1494. https://doi.org/10.
1158/0008‐5472.CAN‐07‐0562
33. Cerniglia GJ, Karar J, Tyagi S, et al. Inhibition of autophagy as
a strategy to augment radiosensitization by the dual phospha￾tidylinositol 3‐kinase/mammalian target of rapamycin inhibitor
NVP‐BEZ235. Mol Pharmacol. 2012;82(6):1230‐1240. https://
doi.org/10.1124/mol.112.080408
34. Chaachouay H, Ohneseit P, Toulany M, Kehlbach R, Multhoff G,
Rodemann HP. Autophagy contributes to resistance of tumor
cells to ionizing radiation. Radiother Oncol. 2011;99(3):287‐292.

https://doi.org/10.1016/j.radonc.2011.06.002