Pterostilbene alleviates fructose-induced renal fibrosis by suppressing TGF-β1/TGF-β type I receptor/Smads signaling in proximal tubular epithelial cells

Ting-Ting Gu, Tian-Yu Chen, Yan-Zi Yang, Xiao- Juan Zhao, Yang Sun, Tu-Shuai Li, Dong-Mei Zhang, Ling-Dong Kong

 

PII: S0014-2999(18)30583-1

DOI: https://doi.org/10.1016/j.ejphar.2018.10.008 Reference: EJP72014

To appear in: European Journal of Pharmacology

Received date: 7 May 2018

Revised date: 30 September 2018

Accepted date: 10 October 2018

Cite this article as: Ting-Ting Gu, Tian-Yu Chen, Yan-Zi Yang, Xiao-Juan Zhao, Yang Sun, Tu-Shuai Li, Dong-Mei Zhang and Ling-Dong Kong, Pterostilbene alleviates fructose-induced renal fibrosis by suppressing TGF-β1/TGF-β type I receptor/Smads signaling in proximal tubular epithelial cells, European Journal of Pharmacology, https://doi.org/10.1016/j.ejphar.2018.10.008

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Pterostilbene alleviates fructose-induced renal fibrosis by suppressing

TGF-β1/TGF-β type I receptor/Smads signaling in proximal tubular epithelial cells

Ting-Ting Gu, Tian-Yu Chen, Yan-Zi Yang, Xiao-Juan Zhao, Yang Sun, Tu-Shuai Li, Dong-Mei Zhang*, Ling-Dong Kong*

State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, P. R. China

*Correspondence authors. [email protected] [email protected]

Abstract:

High dietary fructose is a key causative factor in the development of renal fibrosis. Pterostilbene has anti-fibrotic effect. Understanding the action mechanism of pterostilbene in fructose-induced renal fibrosis remains as a challenge. Here, fructose feeding was found to promote the progress of epithelial-to-mesenchymal transition (EMT) of proximal tubule epithelial cells (PTECs) and collagen deposition in renal cortex of rats with tubulointerstitial fibrosis. Simultaneously, it impaired insulin receptor (IR)/insulin receptor substrate-1 (IRS-1)/protein kinase B (Akt) pathway, and increased transforming growth factor-beta 1 (TGF-β1) and TGF-β type I receptor to enhance phosphorylation of drosophila mothers against decapentaplegic homolog 2 (Smad2) and Smad3, and Smad4 expression in rat kidney cortex. These changes were also observed in cultured PTECs HK-2 cells exposed to 5 mM fructose. The data fromructose-exposed HK-2 cells co-incubated with TGF-β type I receptor inhibitor further demonstrated that the activation of TGF-β1/TGF-β type I receptor/Smads signaling promoted renal tubular EMT and collagen accumulation. Pterostilbene was found to ameliorate fructose-induced renal fibrosis in rats. Importantly, pterostilbene improved IR/IRS-1/Akt pathway impairment and suppressed TGF-β1/TGF-β type I receptor/Smads signaling activation in vivo and in vitro, being consistent with its reduction of EMT and collagen deposition. Upregulation of IR/Akt signaling by pterostilbene was also confirmed in Akt inhibitor (MK-2206 2HCl) or IR inhibitor (GSK1904529A)-treated HK-2 cells. Taken together, pterostilbene may be a promising therapeutic agent for the treatment of fructose-induced kidney fibrosis with insulin signaling impairment.

Keywords:

Pterostilbene; Fructose; EMT; PTECs; Renal fibrosis

1. Introduction

Chronic kidney disease (CKD) has a high prevalence in the general population worldwide (Hocher and Adamski, 2017). Excessive fructose consumption has been shown to cause metabolic syndrome representing as insulin resistance, lipid disorder, and hyperuricemia in animal models and patients, being associated with the development of CKD (Ding et al., 2015; Douard et al., 2010; Lanaspa et al., 2014; Le and Tappy, 2006). Tubulointerstitial fibrosis (TIF) is a common final pathway for almost all CKD progression (Gilbert and Cooper, 1999; Leung et al., 2013; Lorenzen et al., 2011; Trionfini et al., 2015). Multiple studies show that epithelial-mesenchymal transition (EMT) of proximal tubular epithelial cells (PTECs) contributes to the progression of renal TIF (Grabias and Konstantopoulos, 2012). Progressive loss functional PTECs characterized by loss of junctional and intercellular adhesion proteins (e.g., E-cadherin), transition of PTECs to a mesenchymal phenotype with acquisition of mesenchymal markers (e.g., α-smooth muscle actin, α-SMA), and collagen deposition are resulted from EMT in the kidney (Pozdzik et al., 2008; Yang and Liu, 2001). EMT is frequently mediated by transforming growth factor-β1 (TGF-β1), a most important profibrogenic factor for CKD (Lovisa et al., 2015; Schnaper et al., 2009). TGF-β1, acting as a ligand, binds to TGF-β type II receptor, and then dimerizes with TGF-β type I receptor. When TGF-β receptor is activated, drosophila mothers against decapentaplegic homolog 2 (Smad2) and Smad3 are phosphorylated, forming a heteromeric complex with Smad4, which in turn translocates to the nucleus and regulates transcription of downstream profibrotic genes, such as collagen and α-SMA (Schnaper et al., 2009). Previous studies show that T GF­β1/TGF-β receptor signaling is frequently activated in diabetic kidney of db/db mice (Tampe and Zeisberg, 2014; Ziyadeh et al., 2000). Moreover, tubulointerstitial injury and collagen deposition are detected in renal cortex of fructose-fed rodents (Aoyama et al., 2012; Nakayama et al., 2010; Prince et al., 2016). Our previous study also showed that high fructose intake induced renal insulin resistance (Gu et al., 2017) with high TGF-β1 levels in rats (Zhang et al., 2012). But whether EMT process of PTECs occurs in fructose-induced renal fibrosis and the potential underlying molecular mechanism are largely still unexplored.

Pterostilbene, a natural dimethoxylated analog of resveratrol in blueberries and grapes (Estrela et al., 2013; Zhang and Zhang, 2016), shows several pharmacological activities, such as anti-oxidation, anti-inflammation, anti-hyperlipidaemia and anti-diabetes (Elango et al., 2016; Wang et al., 2015). Pterostilbene reduces serum glucose and insulin levels in streptozotocin-induced hyperglycemic rats(Bhakkiyalakshmi et al., 2014; Elango et al., 2016), and may target TGF-β1/Smads signaling to suppress liver fibrosis in dimethylnitrosamine-treated rats (Lee et al., 2013). Recently, pterostilbene is reported to inhibit EMT process in patients with breast cancer (Su et al., 2015). Our previous studies showed that pterostilbene alleviated fructose-induced podocyte injury and albuminuria in rats (Wang et al., 2015), and improved kidney function in hyperuricemic mice (Shi et al., 2012).

However, little is known about its anti-fibrotic effect and potential underlying molecular mechanism in fructose-induced renal fibrosis. In this study, we demonstrated the protective effect of pterostilbene against fructose-induced renal cortex fibrosis by suppressing TGF-β1/TGF-β type I receptor/Smads signaling to attenuate EMT of PTECs by using in vitro and in vivo models.

2. Materials and methods

2.1 Animals

Animal welfare and experimental procedures were carried out in accordance with the China Council on Animal Care at Nanjing University [SYXK (SU) 2009-0017]. Male Sprague-Dawley rats (180-220 g), purchased from Laboratory Animal Center (Nanjing Medical University, China; Production license: SCXK (Jing) 2012-0001) were maintained under controlled temperature (22 ± 2°C), humidity (55 ± 5%) and a 12-h light/12-h dark cycle with the lights on from 09:00 a.m. to 09:00 p.m.. They were given a standard chow and water ad libitum and one week for acclimatization before the experiments. All animals received regular standard chow for 12 weeks.

They were given normal drinking water (normal control group, n = 7/group) or 10% (wt/vol) fructose in drinking water for 12 weeks (Gu et al., 2017; Prince et al., 2016).

Each rat was given 100 mL drinking water or drinking water containing 10% fructose (wt/vol) per day (Zhao et al., 2017). After 6-week fructose feeding, rats were randomly divided into the following groups (n = 7/group): a fructose-vehicle group receiving physiological saline ad libitum; pterostilbene (Sigma-Aldrich, MO, USA) treatment groups with different doses (10, 20 and 40 mg/kg); and a positive drug group receiving pirfenidone (100 mg/kg, Sigma-Aldrich). Physiological saline, pterostilbene and pirfenidone were given orally gavage once daily at 2:00-3:00 p.m. These six groups were reprocessed for an additional 6 weeks. The doses were chosen based on our previous experiments and /or other preclinical experiments (Miric et al., 2001; Tsuchiya et al., 2004; Wang et al., 2015). Of note, pterostilbene exhibits high level of penetration to kidney (8.9-fold higher than that of plasma) after a single oral dose of 40 mg/kg in Sprague-Dawley rats (Choo et al., 2014). Meanwhile, pterostilbene is generally safe without any major adverse drug reactions used in humans (up to 250 mg/day) (Riche et al., 2013). Pirfenidone is a known anti-fibrotic drug for treating human idiopathic pulmonary fibrosis approved by the Food and Drug Administration in the USA (King et al., 2014). Pirfenidone is also reported to reduce glomerulosclerosis and tubulointerstitial fibrosis in db/db mice, indicating that it is a potential alternative to reverse renal fibrosis (RamachandraRao et al., 2009; Tampe and Zeisberg, 2014). Therefore, pirfenidone was chosen to be the positive control drug.

2.2 Blood and kidney sample collection

Each rat was anesthetized with intraperitoneal injection of pentobarbital sodium (40 mg·kg-1). Blood samples were collected as described elsewhere (Gu et al., 2017).

Kidney samples were extirpated from abdominal cavity of rats on ice, and weighed.Kidney coefficient was determined by weight ratio of kidney to body. Renal cortex samples were dissected quickly on ice, and parts of them were immediately fixed for histopathology analysis, while others were stored in liquid nitrogen for Western blot and quantitative real-time PCR (qRT-PCR) analysis, respectively.

2.3 Histopathology and immunostaining

Pathological sections of rat renal cortex tissues were prepared as described elsewhere (Gu et al., 2017). Sections were deparaffinized in xylene, rehydrated in decreasing concentrations of alcohol in water, and stained with masson reagent (JianCheng, Bioengineering Institute, China). The slides were mounted with neutral balsam and examined by optical microscope (IX53, Olympus, Tokyo, Japan).Immunohistochemical staining was performed with E-cadherin and α-SMA, respectively. Immunofluorescent staining was performed with TGF-β1 and TGF-β type I receptor, respectively. Primary antibodies of E-cadherin (76055, 1:50), α-SMA (5694, 1:50) and TGF-β1 (27969, 1:50) from Abcam (Cambridge, MA, USA), and of TGF-β type I receptor (3712, 1:50) from Cell Signaling Technology (Boston, MA, USA) were incubated overnight at 4 °C. For immunohistochemistry, secondary antibodies of goat anti-mouse IgG conjugated with biotin (BA1001, 1:200) and goat anti-rabbit conjugated with biotin (BA1003, 1:200) from Boster Biological Technology Co.,Ltd (Wuhan, China) were incubated for 60 min at 37 °C, respectively. Sections were counterstained with hematoxylin (Boster), mounted with neutral balsam and examined by optical microscope (IX53, Olympus). For immunofluorescence, secondary antibodies of Alexa Fluor® 488 goat anti-rabbit IgG (A11008, 1:200) and Alexa Fluor® 555 goat anti-mouse IgG (A21424, 1:200) from Invitrogen (Carlsbad, CA, USA) were incubated for 60 min at 37 °C, respectively.These sections were examined by epifluorescent microscopy (IX53, Olympus).

2.4 Cell culture and treatment

HK-2 cells (an immortalized proximal tubule epithelial cell line from adult human kidney) were purchased from Cell Bank of Chinese Academy of Science, supplied by ATCC in Wuhan University (Wuhan, China), and cultured in Keratinocyte Serum Free Medium (K-SFM) (Gibco, Invitrogen, CA, USA) supplemented with two additives (Gibco), including bovine pituitary extract (BPE) and human recombinant epidermal growth factor (EGF) at 37 °C in a humidified 5% CO2 air atmosphere.

After 12 h starvation in serum-free medium for synchronization, HK-2 cells were subsequently incubated with 0.1% DMSO (vol/vol) (control group), 5 mM fructose (Sigma-Aldrich) with 0.1% DMSO (vehicle group), 1, 5 or 10 μM pterostilbene, or 50 μM pirfenidone for 8 h to detect TGF-β1 protein levels or 24 h to detect morphological change by phase contrast microscope (CKX41, Olympus), protein levels of p-insulin receptor (IR) (Tyr1345), p-insulin receptor substrate-1 (IRS-1) (Tyr896), p-Akt, TGF-β type I receptor, p-Smad2, p-Smad3, Smad4, collagen III and α-SMA by Western blot analysis, mRNA levels of collagen III by qRT-PCR analysis, as well as TGF-β1 levels in cell culture supernatants by using commercial ELISA kit (Elabscience, Wuhan, China), respectively.

To explore whether pterostilbene had beneficial effect on key proteins of insulin signaling, HK-2 cells were cultured in K-SFM medium with Akt inhibitor MK-2206 2HCl (10 μM) or IR inhibitor GSK1904529A (100 μM) at presence or absence of pterostilbene (5 μM) for 24 h to detect protein levels of p-AKT or p-IR by Western blot analysis, respectively. To examine whether TGF-β1/TGF-β type I receptor/Smads signaling mediated EMT and collagen deposition under fructose exposure, HK-2 cellswere cultured in K-SFM medium with or without fructose (5 mM) in the presence or absence of a TGF-β type I receptor inhibitor SD208 (1 μM, Selleck Chemicals, TX, USA), pterostilbene (5 μM), or pirfenidone (50 μM) for 24 h to detect protein levels of p-Smad2, p-Smad3, Smad4, collagen III, E-cadherin and α-SMA by Western blot analysis, respectively. To further explore whether pterostilbene regulated Smads independently, HK-2 cells were cultured in K-SFM medium with Samds inhibitor LY2109761 (5 μM) in the presence or absence of pterostilbene (5 μM) for 24 h to detect protein levels of p-Smad2, p-Smad3 and Smad4 by Western blot analysis, respectively. The protein concentrations were determined by BCA protein assay kit (Pierce, Rockford, USA).

In all experiments, cell lysates and/or culture supernatants were collected. These samples were stored at -80 °C until assays. The protein concentrations were determined by BCA protein assay kit (Pierce, Rockford, USA). Total intracellular protein and RNA were extracted from cell lysates for Western blot and qRT-PCR assay, respectively. Dosages of fructose, pterostilbene and pirfenidone were selected based on our preliminary experiments and other reports (Chen et al., 2013; Cirillo et al., 2009; Di Sario et al., 2002; Gu et al., 2017; Wang et al., 2015).

2.5 Biochemical analysis

Serum insulin or hyaluronic acid levels were determined by commercially ELISA kits from Crystal Chem Inc. (Chicago, IL, USA) or R&D systems (Minneapolis, MN, USA), respectively. TGF-β1 levels of serum or cell culture supernatants were detected following the instructions of commercial ELISA kit from Elabscience. Serum total triglycerides (TG) and cholesterol (TC) levels were assayed by standard diagnostic kits (JianCheng), respectively.

2.6 qRT-PCR analysis

The total RNA of rat renal cortex tissues and HK-2 cells were isolated using Trizol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions, respectively. For qRT-PCR analysis, single-stranded cDNA was prepared from 2 μg mRNA by reverse transcription using HiScript II Q RT SuperMix for qPCR (+gDNA wiper) supplied by Vazyme Biotech Co.,Ltd (Nanjing, China). The reverse transcription reaction was conducted according to the instruction of theabove-mentioned kit.qRT-PCR analysis of mRNAs was performed using SYBR Green I dye (Bio-Rad Laboratories, Hercules, CA, USA) according to manufacturer’s protocol. Briefly, cDNA sample was amplified in 96-well optical reaction plates (Invitrogen) containing 2 μl of cDNA, 10 μl of iTaqTM Universal SYBR® Green Supermix, 1 μl of 10 μM primers (forward and reverse primers, mRNA) and added H2O-DEPC to 20 μl. The reaction mix was incubated in a CFX96 Real-Time PCR Detection System (Bio-Rad) (1 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 20 s at 55 °C, melt curve and plate read). The fluorescence signal generated with SYBR Green I DNA dye was measured during annealing steps. Specificity of the amplification was confirmed using a melting curve analysis. Data were collected and recorded by CFX Manager Software (Bio-Rad) and expressed as a function of threshold cycle (Ct). The samples for qRT-PCR analysis were evaluated using a single predominant peak as a quality control. Comparative Ct (2-∆∆Ct method) method was used to analysis the relative expressions of mRNAs that were normalized to β-actin. All the primers for mRNA were synthesized by Shanghai Generay Biotech Co.,Ltd (Shanghai, China). qRT-PCR was performed with selective primers for β-actin (homo, Gene ID: 60) (Forward:

CTACCTCATGAAGATCCTCACCGA; Reverse: TTCTCCTTAATGTCACGCACGATT), collagen III (homo, Gene ID: 1281)

(Forward: CAAATGGAATTTCTGGGTTGG; Reverse: CATCTTGGTCAGTCCTATGCG), β-actin (rat, Gene ID: 81822) (Forward: GAGAGGGAAATCGTGCGT; Reverse: GGAGGAAGAGGATGCGG), collagen III

(rat, Gene ID: 84032) (Forward: ACTGTCTTGCTCCATTCACCA; Reverse: CTCCCAGAACATTACATACCAC), TGF-β type I receptor (rat, Gene ID: 29591) (Forward: CCTGTTGACTGAGTTGCGATAA; Reverse: CCTTCTGACCCATCAGTTGAA) and Smad4 (rat, Gene ID: 50554) (Forward: GCAGTCCTACTTCCAGTCCAG; Reverse: ACCAACTTCCCCAACATTCCT).

2.7 Western blot analysis

Methods for protein extraction of rat renal cortex samples and HK-2 cells, as well as blots preparation have been previously published (Gu et al., 2017). The primary antibodies used included: TGF-β type II receptor (186838), collagen III (6310) andα-SMA (5694), purchased from Abcam; Smad2 (#5339), Smad3 (#9523), TGF-β type I receptor (#3712), Akt (#4685), p-Akt (#4060), IR (#3025), p-IR (Tyr1345, #3026)and IRS-1 (#2390), purchased from Cell Signaling Technology; p-IRS-1 (Tyr896, SAB4504661), purchased from Sigma-Aldrich; Phospho-Smad2 (101801), p-Smad3 (130218), Smad4 (7966) and TGF-β1 (146), purchased from Santa Cruz Biotechnology Inc., and β-actin (ABM-0001), purchased from Zoonbio Biotechnology Co.,Ltd. (Nanjing, China). Blots were incubated overnight at 4°C in primary antibody with a 1:1000 dilution in 5% skim milk followed byHRP-conjugated anti-rabbit IgG antibody (074-1506, 1:1000) from KPL (Gaithersburg, MD, USA), HRP-conjugated goat anti-mouse IgG antibody (2517746,:1000) from Millipore or Goat IgG Horseradish Peroxidase-conjugated antibody (HAF017, 1:5000) from R&D systems, respectively. Immunoreactive bands were visualized via the enhanced chemiluminescence (Cell Signaling) and exposed to

X-ray film (Kodak, New Haven, CT, USA), then quantified via densitometry using Image J software (version 1.48v, NIH, Bethesda, MD).

2.8 Statistical analysis

The data were expressed as means ± S.E.M.. Statistical analysis was performed using Mann-Whitney test. A value of P < 0.05 was considered statistically significant.

3. Results

3.1 Pterostilbene attenuates fructose-induced hyperinsulinemia, dyslipidemia and kidney coefficient change in rats

As expected (Abdelkarem et al., 2016; Wang et al., 2015), fructose feeding increased serum insulin, TG and TC levels in rats (Table 1). Pterostilbene but not pirfenidone markedly reduced serum insulin, TG and TC levels in fructose-fed rats (Table 1).Moreover, pterostilbene and pirfenidone attenuated fructose-induced the increased kidney coefficient in rats (Fig. 1A).

3.2 Pterostilbene improves insulin signaling in kidney cortex of fructose-fed rats and fructose-exposed HK-2 cells.

Fructose feeding reduced protein levels of p-IR (Tyr1345), p-IRS-1 (Tyr 896) and p-Akt (Ser473) in kidney cortex of rats (Fig. 1B-D). This IR/IRS-1/Akt signaling impairment was also observed in fructose-exposed HK-2 cells (Fig. 1E-G).Pterostilbene up-regulated p-IR (Tyr1345), p- IRS-1 (Tyr 896) and p-Akt (Ser473) inrenal cortex of fructose-fed rats (Fig. 1B-D) and fructose-exposed HK-2 cells (Fig. 1E-G). However, pirfenidone did not affect insulin signaling in these animal and cell models.

To explore whether pterostilbene had beneficial effect on key proteins of insulin signaling, HK-2 cells were treated with Akt inhibitor MK-2206 2HCl or IR inhibitor GSK1904529A at presence or absence of pterostilbene. MK-2206 2HCl decreasedp-AKT protein levels in HK-2 cells, which were up-regulated by pterostilbene (Fig. 1H). GSK1904529A inhibited protein levels of p-IR, and further blocked p-AKT protein levels in HK-2 cells (Fig. 1I-J). These reductions were attenuated by pterostilbene (Fig. 1I-J).

3.3 Pterostilbene alleviates renal cortex fibrosis in fructose-fed rats, with the suppression of EMT and collagen deposition

Fructose feeding increased rat serum levels of hyaluronic acid (Fig. 2A) and TGF-β1 (Fig. 2B), which were attenuated by pterostilbene and pirfenidone (Fig. 2A-B). In addition, pterostilbene and pirfenidone relieved extensive TIF in renal cortex of fructose-fed rats observed by Masson staining (Fig. 2C). Immunohistochemical staining of renal cortex illustrated that E-cadherin protein expression was significantly decreased (Fig. 2C), while α-SMA protein expression was increased (Fig. 2C), further demonstrating renal tubular epithelial cell injury in fructose-fed rats. Moreover, decreased E-cadherin (Fig. 2D) and increased α-SMA (Fig. 2E) at protein levels were also detected in renal cortex of fructose-fed rats by Western blot assay. Pterostilbene and pirfenidone attenuated fructose-induced change of E-cadherin and α-SMA in renal cortex of fructose-fed rats (Fig. 2C-E). Moreover, collagen III protein levels (Fig. 2F) as well as its fructose-fed rats, which were attenuated by pterostilbene and pirfenidone (Fig. 2F-G).

Furthermore, the cell morphology changes were observed in fructose-exposed HK-2 cells (Fig. 2H), while control group showed the normal elliptical morphology. Under high fructose induction, HK-2 cells underwent morphological changes, from cobblestone-like shapes to spindle shapes, resulting in dispersion and loose contact array. Up-regulation of α-SMA protein levels (Fig. 2I) as well as collagen III protein and mRNA levels (Fig. 2J-K) was observed in fructose-exposed HK-2 cells.

Pterostilbene and pirfenidone prevented these morphological changes, anddown-regulated α-SMA protein levels, collagen III protein and mRNA levels in this cell model (Fig. 2H-K).

3.4 Pterostilbene suppresses TGF-β1/TGF-β type I receptor/Smads signaling activation in renal cortex of fructose-fed rats and fructose-exposed HK-2 cells TGF-β1 is a key regulator of EMT in the development of kidney fibrosis (Lovisa et al., 2015; Schnaper et al., 2009). In this study, TGF-β1 and TGF-β type I receptor protein levels (Fig. 3A-B) as well as TGF-β type I receptor mRNA levels (Fig. 3C) were significantly increased in renal cortex of fructose-fed rats. However, TGF-β type II receptor protein levels were not changed in this animal model (Fig. 3D). Consistently, protein levels of renal cortex p-Smad2 and p-Smad3, as well as protein and mRNA levels of Smad4 were increased in fructose-fed rats (Fig. 3E-H). Activation ofTGF-β1/TGF-β type I receptor/Smads signaling was also found in fructose-exposed HK-2 cells. Fructose increased TGF-β1 protein levels and secretion (Fig. 3I-J), and TGF-β type I receptor protein levels (Fig. 3K), but failed to alter TGF-β type II receptor protein levels (Fig. 3L) in HK-2 cells. Furthermore, fructose increased protein levels of p-Smad2, p-Smad3 and Smad4 in HK-2 cells (Fig. 3M-O).

Pterostilbene and pirfenidone were found to reduce protein levels of TGF-β1, TGF-β type I receptor, p-Smad2, p-Smad3 and Smad4 (Fig. 3A-B, E-G) as well as mRNA levels of TGF-β type I receptor and Smad4 (Fig. 3C and H) in renal cortex of fructose-fed rats. They also reversed fructose-induced activation of TGF-β1/TGF-β type I receptor/Smads signaling in HK-2 cells (Fig. 3I-K, M-O).

3.5 Pterostilbene blocks TGF-β1/TGF-β type I receptor/Smads signaling to alleviate EMT and collagen deposition in fructose-exposed HK-2 cells

To investigate the role of TGF-β1/TGF-β type I receptor/Smads signaling activation in EMT and collagen deposition under fructose exposure, firstly, immunostaining of TGF-β1 and TGF-β type I receptor as well as nucleus protein levels of Smad4 were detected and found to be increased in renal cortex of fructose-fed rats (Fig. 4A-D).Next, HK-2 cells were co-treated with a TGF-β type I receptor inhibitor SD208 and fructose for 24 h. The inhibition efficiency of SD208 on TGF-β type I receptor protein levels in HK-2 cells were verified by Western blot analysis (Fig. 4E). SD208 blocked fructose-induced alteration of p-Smad2 (Fig. 4F), p-Smad3 (Fig. 4G), and Smad4 (Fig. 4H) at protein levels in fructose-exposed HK-2 cells. Furthermore, fructose-induced down-regulation of E-cadherin (Fig. 4I), up-regulation of α-SMA and collagen III (Fig. 4J-K) were reversed by SD208 in HK-2 cells.

Pterostilbene and pirfenidone down-regulated protein levels of TGF-β1, TGF-β type I receptor and Smad4 (nucleus) in renal cortex of fructose-fed rats (Fig. 4A-D).In SD208-treated HK-2 cells, pterostilbene and pirfenidone attenuatedfructose-induced up-regulation of p-Smad2 and p-Smad3, as well as Smad4 protein levels (Fig. 4F-H). They also modified fructose-induced E-cadherin decrease, as well as α-SMA and collagen III increases in SD208-treated HK-2 cells (Fig. 4I-K).

To further explore the effects of pterostilbene on Smads, HK-2 cells were treated with Smads inhibitor LY2109761 at presence or absence of pterostilbene. LY2109761 decreased protein levels of p-Smad2 (Fig. 4L), p-Smad3 (Fig. 4M) and Smad4 (Fig.4N) in HK-2 cells, but pterostilbene failed to restore LY2109761-induced these reductions (Fig. 4L-N).

4. Discussion

PTECs comprise the majority of the kidney’s parenchyma (Hodgkins and Schnaper, 2012; Tampe and Zeisberg, 2014). In fibrosis, EMT of PTECs, characterized by loss of epithelial markers and acquisition of mesenchymal markers, possibly initiates and promotes the progression of renal TIF, which gradually causes the loss of kidney function in CKD (Grabias and Konstantopoulos, 2012; Zeisberg et al., 2003).

Pterostilbene has various pharmacologic properties. Our study firstly provided the experimental evidence that pterostilbene partially reversed fructose-induced EMT of PTECs to relieve kidney fibrosis in rats. In this study, pterostilbene was found to markedly reduce collagen deposition and TIF through modulating TGF-β1/TGF-β type I receptor/Smads signaling activation and insulin signaling inhibition in renal cortex of fructose-fed rats.

Fructose is reported to induce tubulointerstitial injury and collagen deposition in renal cortex of rodents (Aoyama et al., 2012; Nakayama et al., 2010; Prince et al., 2016). Our current study firstly demonstrated that high fructose could induce renal cortex EMT and TIF progress in rats. Moreover, fructose-induced collagen deposition and EMT of PTECs were also observed in vitro. The underlying mechanism may be associated with TGF-β1, which is known as the most important regulator in renal fibrosis marked with EMT of PTECs (Lovisa et al., 2015). Our previous study the up-regulation of renal cortex TGF-β1 with renal endothelial dysfunction in fructose-fed rats (Zhang et al., 2012). In the current study,

TGF-β1/TGF-β type I receptor/Smads signaling pathway was activated in renal cortex of fructose-fed rats and fructose-exposed PTECs. As a result, EMT and TIF of renal cortex were impaired. These results were further validated by using TGF-β type I receptor antagonist SD208. These observations indicated that EMT of PTECs induced by fructose was possibly through the activation of TGF-β1/TGF-β type I receptor/Smads signaling. Of note, Smad2 is protective in kidney fibrosis. It is manifested that Smad2 deletion in PTECs enhances Smad3-dependent renal fibrosis in vivo and in vitro (Meng et al., 2010). However, p-Smad2 is increased in kidney disease with diabetes and Alport syndrome (Li et al., 2004; Williams et al., 2018). In this study, increased p-Smad2 was also observed in renal cortex of fructose-fed rats.

In addition, Smad2 is reported to be crucial in delayed events such as induction ofα-SMA, suggesting that Smad2 may also play an important role in the development of tubule-interstitial fibrosis (Phanish et al., 2006). Pterostilbene improves systematic or hepatic glycaemic control in an obesogenic or fructose enriched diet-fed rats with insulin resistance (Gomez-Zorita et al., 2015; Grover et al., 2005). Pterostilbene blocks TGF-β1/Smads pathway and decreases hepatic collagen deposition in dimethylnitrosamine-treated rats (Lee et al., 2013), and inhibits EMT in patients with breast cancer (Su et al., 2015). Our previous studies demonstrated the renal protective effect of pterostilbene in fructose-fed or hyperuricemic rodents (Shi et al., 2012; Wang et al., 2015). However, little is known about the anti-fibrotic effect of pterostilbene by inhibiting EMT occurrence in fructose-induced renal injury. Pirfenidone, a small synthetic molecule initially developed, targets idiopathic pulmonary fibrosisspecifically by blocking TGF-β promoter to reduce protein secretion (Kingwell, 2014).

Pirfenidone has anti-fibrotic property without affecting metabolic profiles in a mouse model with human non-alcoholic steatohepatitis-like phenotypes (Komiya et al., 2017). Pirfenidone reduces collagen deposition and mRNA levels, and blocks TGF-β to improve renal function and fibrosis in ureteral obstruction fibrosis model of mice (Shimizu et al., 1998). In this study, pterostilbene and pirfenidone were found to ameliorate fructose-induced EMT of PTECs, resulting in renal cortex TIF recovery in rats. Moreover, pterostilbene and pirfenidone significantly down-regulated renal cortex TGF-β1/TGF-β type I receptor/Smads signaling, and collagen accumulation driven by fructose, being consistent with the alleviation of renal cortex fibrosis in rats. Of note, the disturbance on TGF-β1-mediated signaling activation by TGF-β type I receptor inhibitor SD208 suggested that pterostilbene and pirfenidone could alleviate fructose-induced EMT of PTECs, possibly through suppressing renal cortex

TGF-β1/TGF-β type I receptor/Smads activation.

Renal insulin signaling impairment exacerbates the progression of CKD (Gu et al., 2017). Insulin resistance coordinates with fibrosis progress closely in adipocytes (Trayhurn, 2013) or liver (Jacobson et al., 2010). Meanwhile, tubulointerstitial damage usually co-occurs with insulin resistance in Zucker diabetic fatty rats (Figarola et al., 2008). Consistent with our previous study (Gu et al., 2017), renal insulin signaling impairment evidenced by down-regulation of protein levels of p-IR, p-IRS-1 and p-Akt was observed in renal cortex of fructose-fed rats andfructose-exposed HK-2 cells. In this study, insulin signaling impairment was simultaneously found in fructose-induced EMT of PTECs and kidney fibrosis. Pterostilbene is reported to alleviate renal tubular epithelial damage in diabetic rats (Amarnath Satheesh and Pari, 2006). We found that pterostilbene up-regulated p-IR, p-IRS-1 and p-Akt in animal and cell models. Pterostilbene also attenuated thesuppressions of p-IR and the downstream p-AKT after IR blockage in HK-2 cells. Therefore, the alleviation of pterostilbene on fructose-induced renal fibrosis may result from its improvement of insulin signaling.

In conclusion, the present study demonstrated that pterostilbene exhibited renal protective effects against fructose-induced kidney fibrosis in rats. Pterostilbene was found to inhibit fructose-induced EMT of PTECs, in which the suppression of renal cortex TGF-β1/TGF-β type I receptor/Smads signaling activation and insulin signaling impairment may play a crucial role. These results suggest that pterostilbene may be a promising therapeutic agent for the prevention and treatment of fructose-induced kidney fibrosis with insulin signaling impairment.

Acknowledgements

This work was supported by Grants from the National Natural Science Foundation of China (No. 81730105 and 81673488). L.D.K. conceived the study. L.D.K. and T.T.G. designed the study. T.T.G., X.J.Z. and T.Y.C. performed the animal experiments.

T.T.G., Y.Z.Y., T.Y.C. and S.T.L. conducted the cell experiments. T.T.G. and T.Y.C. got the experimental data. T.T.G., D.M.Z., L.D.K. Y.S. and T.Y.C. analyzed and interpreted the data. L.D.K., D.M.Z.,T.T.G. and Y.S. wrote and revised the manuscript.

Conflicts of interests

The authors have declared no conflicts of interest.

Author contributions：

L.D.K. conceived the study. L.D.K. and T.T.G. designed the study. T.T.G., X.J.Z. and T.Y.C. performed the animal experiments. T.T.G., Y.Z.Y., T.Y.C. and S.T.L. conducted the cell experiments. T.T.G. and T.Y.C. got the experimental data. T.T.G.,

D.M.Z., L.D.K. Y.S. and T.Y.C. analyzed and interpreted the data. L.D.K., D.M.Z.,T.T.G. and Y.S. wrote and revised the manuscript.

References:

Abdelkarem, H.M., Fadda, L.H., Hassan, A.A., 2016. Potential intervention of alpha- lipoic acid and carnitine on insulin sensitivity and GSK1904529A anti-inflammatory cytokines levels in fructose-fed rats, a model of metabolic syndrome. J. Diet Suppl., 1-11.

Amarnath Satheesh, M., Pari, L., 2006. The antioxidant role of pterostilbene in streptozotocin-nicotinamide-induced type 2 diabetes mellitus in Wistar rats. J. Pharm. Pharmacol. 58, 1483-1490.

Aoyama, M., Isshiki, K., Kume, S., Chin-Kanasaki, M., Araki, H., Araki, S., Koya, D., Haneda, M., Kashiwagi, A., Maegawa, H., Uzu, T., 2012. Fructose induces tubulointerstitial injury in the kidney of mice. Biochem. Biophys. Res. Commun. 419, 244-249.

Bhakkiyalakshmi, E., Shalini, D., Sekar, T.V., Rajaguru, P., Paulmurugan, R., Ramkumar, K.M., 2014. Therapeutic potential of pterostilbene against pancreatic beta-cell apoptosis mediated through Nrf2. Br. J. Pharmacol. 171, 1747-1757.

Chen, J.F., Liu, H., Ni, H.F., Lv, L.L., Zhang, M.H., Zhang, A.H., Tang, R.N., Chen, P.S., Liu, B.C., 2013. Improved mitochondrial function underlies the protective effect of pirfenidone against tubulointerstitial fibrosis in 5/6 nephrectomized rats. PLoS One 8, e83593.

Choo, Q.Y., Yeo, S.C.M., Ho, P.C., Tanaka, Y., Lin, H.S., 2014. Pterostilbene surpassed resveratrol for anti-inflammatory application: Potency consideration and pharmacokinetics perspective. J. Funct. Foods 11, 352-362.

Cirillo, P., Gersch, M.S., Mu, W., Scherer, P.M., Kim, K.M., Gesualdo, L., Henderson, G.N., Johnson, R.J., Sautin, Y.Y., 2009. Ketohexokinase-dependent metabolism of fructose induces proinflammatory mediators in proximal tubular cells. J. Am. Soc.

Nephrol. 20, 545-553.

Di Sario, A., Bendia, E., Svegliati Baroni, G., Ridolfi, F., Casini, A., Ceni, E., Saccomanno, S., Marzioni, M., Trozzi, L., Sterpetti, P., Taffetani, S., Benedetti, A., 2002. Effect of pirfenidone on rat hepatic stellate cell proliferation and collagen production. J. Hepatol. 37, 584-591.

Ding, X.Q., Gu, T.T., Wang, W., Song, L., Chen, T.Y., Xue, Q.C., Zhou, F., Li, J.M.,

Kong, L.D., 2015. Curcumin protects against fructose-induced podocyte insulin signaling impairment through upregulation of miR-206. Mol. Nutr. Food. Res. 59, 2355-2370.

Douard, V., Asgerally, A., Sabbagh, Y., Sugiura, S., Shapses, S.A., Casirola, D., Ferraris, R.P., 2010. Dietary fructose inhibits intestinal calcium absorption and induces vitamin D insufficiency in CKD. J. Am. Soc. Nephrol. 21, 261-271.

Elango, B., Dornadula, S., Paulmurugan, R., Ramkumar, K.M., 2016. Pterostilbene ameliorates streptozotocin-induced diabetes through enhancing antioxidant signaling pathways mediated by Nrf2. Chem. Res. Toxicol. 29, 47-57.

Estrela, J.M., Ortega, A., Mena, S., Rodriguez, M.L., Asensi, M., 2013. Pterostilbene: Biomedical applications. Crit. Rev. Clin. Lab Sci. 50, 65-78.

Figarola, J.L., Loera, S., Weng, Y., Shanmugam, N., Natarajan, R., Rahbar, S., 2008. LR-90 prevents dyslipidaemia and diabetic nephropathy in the Zucker diabetic fatty rat. Diabetologia 51, 882-891.

Gilbert, R.E., Cooper, M.E., 1999. The tubulointerstitium in progressive diabetic

kidney disease: more than an aftermath of glomerular injury? Kidney Int. 56, 1627-1637.

Gomez-Zorita, S., Fernandez-Quintela, A., Aguirre, L., Macarulla, M.T., Rimando, A.M., Portillo, M.P., 2015. Pterostilbene improves glycaemic control in rats fed an obesogenic diet: involvement of skeletal muscle and liver. Food Funct. 6, 1968-1976. Grabias, B.M., Konstantopoulos, K., 2012. Epithelial-mesenchymal transition and fibrosis are mutually exclusive reponses in shear-activated proximal tubular epithelial cells. FASEB J. 26, 4131-4141.

Grover, J.K., Vats, V., Yadav, S.S., 2005. Pterocarpus marsupium extract (Vijayasar) prevented the alteration in metabolic patterns induced in the normal rat by feeding an adequate diet containing fructose as sole carbohydrate. Diabetes Obes. Metab. 7,

414-420.

Gu, T.T., Song, L., Chen, T.Y., Wang, X., Zhao, X.J., Ding, X.Q., Yang, Y.Z., Pan, Y.,

Zhang, D.M., Kong, L.D., 2017. Fructose downregulates miR-330 to induce renal inflammatory response and insulin signaling impairment: Attenuation by morin. Mol Nutr Food Res 61, 1600760.

Hocher, B., Adamski, J., 2017. Metabolomics for clinical use and research in chronic kidney disease. Nat. Rev. Nephrol. 13, 269-284.

Hodgkins, K.S., Schnaper, H.W., 2012. Tubulointerstitial injury and the progression of chronic kidney disease. Pediatr. Nephrol. 27, 901-909.

Jacobson, I.M., Davis, G.L., El-Serag, H., Negro, F., Trepo, C., 2010. Prevalence and challenges of liver diseases in patients with chronic hepatitis C virus infection. Clin. Gastroenterol. Hepatol. 8, 924-933.

King, T.E., Jr., Bradford, W.Z., Castro-Bernardini, S., Fagan, E.A., Glaspole, I., Glassberg, M.K., Gorina, E., Hopkins, P.M., Kardatzke, D., Lancaster, L., Lederer, D.J., Nathan, S.D., Pereira, C.A., Sahn, S.A., Sussman, R., Swigris, J.J., Noble, P.W., Group, A.S., 2014. A phase 3 trial of pirfenidone in patients with idiopathic pulmonary fibrosis. N. Engl. J. Med. 370, 2083-2092.

Kingwell, K., 2014. InterMune and Boehringer blaze trails for idiopathic pulmonary fibrosis drugs. Nat. Rev. Drug Discov. 13, 483-484.

Komiya, C., Tanaka, M., Tsuchiya, K., Shimazu, N., Mori, K., Furuke, S., Miyachi, Y., Shiba, K., Yamaguchi, S., Ikeda, K., Ochi, K., Nakabayashi, K., Hata, K.I., Itoh, M., Suganami, T., Ogawa, Y., 2017. Antifibrotic effect of pirfenidone in a mouse model of human nonalcoholic steatohepatitis. Sci. Rep. 7, 44754.

Lanaspa, M.A., Ishimoto, T., Cicerchi, C., Tamura, Y., Roncal-Jimenez, C.A., Chen, W., Tanabe, K., Andres-Hernando, A., Orlicky, D.J., Finol, E., Inaba, S., Li, N.,

Rivard, C.J., Kosugi, T., Sanchez-Lozada, L.G., Petrash, J.M., Sautin, Y.Y., Ejaz, A.A., Kitagawa, W., Garcia, G.E., Bonthron, D.T., Asipu, A., Diggle, C.P., Rodriguez-Iturbe, B., Nakagawa, T., Johnson, R.J., 2014. Endogenous fructose production and fructokinase activation mediate renal injury in diabetic nephropathy. J. Am. Soc.

Nephrol. 25, 2526-2538.

Le, K.A., Tappy, L., 2006. Metabolic effects of fructose. Curr. Opin. Clin. Nutr. Metab. Care 9, 469-475.

Lee, M.F., Liu, M.L., Cheng, A.C., Tsai, M.L., Ho, C.T., Liou, W.S., Pan, M.H., 2013.

Pterostilbene inhibits dimethylnitrosamine-induced liver fibrosis in rats. Food Chem. 138, 802-807.

Leung, K.C., Tonelli, M., James, M.T., 2013. Chronic kidney disease following acute kidney injury-risk and outcomes. Nat Rev Nephrol 9, 77-85.

Li, J.H., Huang, X.R., Zhu, H.J., Oldfield, M., Cooper, M., Truong, L.D., Johnson, R.J., Lan, H.Y., 2004. Advanced glycation end products activate Smad signaling via

TGF-beta-dependent and independent mechanisms: implications for diabetic renal and vascular disease. FASEB J. 18, 176-178.

Lorenzen, J.M., Haller, H., Thum, T., 2011. MicroRNAs as mediators and therapeutic targets in chronic kidney disease. Nat Rev Nephrol 7, 286-294.

Lovisa, S., LeBleu, V.S., Tampe, B., Sugimoto, H., Vadnagara, K., Carstens, J.L., Wu, C.C., Hagos, Y., Burckhardt, B.C., Pentcheva-Hoang, T., Nischal, H., Allison, J.P., Zeisberg, M., Kalluri, R., 2015. Epithelial-to-mesenchymal transition induces cell cycle arrest and parenchymal damage in renal fibrosis. Nat. Med. 21, 998-1009.

Meng, X.M., Huang, X.R., Chung, A.C., Qin, W., Shao, X., Igarashi, P., Ju, W., Bottinger, E.P., Lan, H.Y., 2010. Smad2 protects against TGF-beta/Smad3-mediated renal fibrosis. J. Am. Soc. Nephrol. 21, 1477-1487.

Miric, G., Dallemagne, C., Endre, Z., Margolin, S., Taylor, S.M., Brown, L., 2001. Reversal of cardiac and renal fibrosis by pirfenidone and spironolactone in streptozotocin-diabetic rats. Br. J. Pharmacol. 133, 687-694.

Nakayama, T., Kosugi, T., Gersch, M., Connor, T., Sanchez-Lozada, L.G., Lanaspa, M.A., Roncal, C., Perez-Pozo, S.E., Johnson, R.J., Nakagawa, T., 2010. Dietary fructose causes tubulointerstitial injury in the normal rat kidney. Am. J. Physiol. Renal. Physiol. 298, F712-720.

Phanish, M.K., Wahab, N.A., Colville-Nash, P., Hendry, B.M., Dockrell, M.E., 2006. The differential role of Smad2 and Smad3 in the regulation of pro-fibrotic TGFbeta1 responses in human proximal-tubule epithelial cells. Biochem. J. 393, 601-607.

Pozdzik, A.A., Salmon, I.J., Debelle, F.D., Decaestecker, C., Van den Branden, C., Verbeelen, D., Deschodt-Lanckman, M.M., Vanherweghem, J.L., Nortier, J.L., 2008. Aristolochic acid induces proximal tubule apoptosis and epithelial to mesenchymal transformation. Kidney Int. 73, 595-607.

Prince, P.D., Lanzi, C.R., Toblli, J.E., Elesgaray, R., Oteiza, P.I., Fraga, C.G., Galleano, M., 2016. Dietary (-)-epicatechin mitigates oxidative stress, NO metabolism alterations, and inflammation in renal cortex from fructose-fed rats. Free Radic. Biol. Med. 90, 35-46.

RamachandraRao, S.P., Zhu, Y., Ravasi, T., McGowan, T.A., Toh, I., Dunn, S.R., Okada, S., Shaw, M.A., Sharma, K., 2009. Pirfenidone is renoprotective in diabetic kidney disease. J. Am. Soc. Nephrol. 20, 1765-1775.

Riche, D.M., McEwen, C.L., Riche, K.D., Sherman, J.J., Wofford, M.R., Deschamp, D., Griswold, M., 2013. Analysis of safety from a human clinical trial with pterostilbene. J. Toxicol. 2013, 463595.

Schnaper, H.W., Jandeska, S., Runyan, C.E., Hubchak, S.C., Basu, R.K., Curley, J.F., Smith, R.D., Hayashida, T., 2009. TGF-beta signal transduction in chronic kidney disease. Front. Biosci. (Landmark Ed) 14, 2448-2465.

Shi, Y.W., Wang, C.P., Liu, L., Liu, Y.L., Wang, X., Hong, Y., Li, Z., Kong, L.D., 2012.

Antihyperuricemic and nephroprotective effects of resveratrol and its analogues in hyperuricemic mice. Mol. Nutr. Food Res. 56, 1433-1444.

Shimizu, T., Kuroda, T., Hata, S., Fukagawa, M., Margolin, S.B., Kurokawa, K., 1998. Pirfenidone improves renal function and fibrosis in the post-obstructed kidney.

Kidney Int. 54, 99-109.

Su, C.M., Lee, W.H., Wu, A.T., Lin, Y.K., Wang, L.S., Wu, C.H., Yeh, C.T., 2015.

Pterostilbene inhibits triple-negative breast cancer metastasis via inducing microRNA-205 expression and negatively modulates epithelial-to-mesenchymal transition. J. Nutr. Biochem. 26, 675-685.

Tampe, D., Zeisberg, M., 2014. Potential approaches to reverse or repair renal fibrosis. Nat. Rev. Nephrol. 10, 226-237.

 

 

Trayhurn, P., 2013. Hypoxia and adipose tissue function and dysfunction in obesity. Physiol. Rev. 93, 1-21.

Trionfini, P., Benigni, A., Remuzzi, G., 2015. MicroRNAs in kidney physiology and disease. Nat Rev Nephrol 11, 23-33.

Tsuchiya, H., Kaibori, M., Yanagida, H., Yokoigawa, N., Kwon, A.H., Okumura, T., Kamiyama, Y., 2004. Pirfenidone prevents endotoxin-induced liver injury after partial hepatectomy in rats. J. Hepatol. 40, 94-101.

Wang, W., Ding, X.Q., Gu, T.T., Song, L., Li, J.M., Xue, Q.C., Kong, L.D., 2015.

Pterostilbene and allopurinol reduce fructose-induced podocyte oxidative stress and inflammation via microRNA-377. Free Radic. Biol. Med. 83, 214-226.

Williams, M.J., Sugatani, T., Agapova, O.A., Fang, Y., Gaut, J.P., Faugere, M.C., Malluche, H.H., Hruska, K.A., 2018. The activin receptor is stimulated in the skeleton, vasculature, heart, and kidney during chronic kidney disease. Kidney Int 93, 147-158. Yang, J., Liu, Y., 2001. Dissection of key events in tubular epithelial to myofibroblast transition and its implications in renal interstitial fibrosis. Am. J. Pathol. 159,

1465-1475.

Zeisberg, M., Hanai, J., Sugimoto, H., Mammoto, T., Charytan, D., Strutz, F., Kalluri, R., 2003. BMP-7 counteracts TGF-beta1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat. Med. 9, 964-968.

Zhang, D.M., Li, Y.C., Xu, D., Ding, X.Q., Kong, L.D., 2012. Protection of curcumin against fructose-induced hyperuricaemia and renal endothelial dysfunction involves NO-mediated JAK-STAT signalling in rats. Food Chem. 134, 2184-2193.

Zhang, Y., Zhang, Y., 2016. Pterostilbene, a novel natural plant conduct, inhibits high fat-induced atherosclerosis inflammation via NF-kappaB signaling pathway in

Toll-like receptor 5 (TLR5) deficient mice. Biomed. Pharmacother. 81, 345-355. Zhao, X.J., Yang, Y.Z., Zheng, Y.J., Wang, S.C., Gu, H.M., Pan, Y., Wang, S.J., Xu,

H.J., Kong, L.D., 2017. Magnesium isoglycyrrhizinate blocks fructose-induced hepatic NF-kappaB/NLRP3 inflammasome activation and lipid metabolism disorder. Eur. J. Pharmacol. 809, 141-150.

Ziyadeh, F.N., Hoffman, B.B., Han, D.C., Iglesias-De La Cruz, M.C., Hong, S.W., Isono, M., Chen, S., McGowan, T.A., Sharma, K., 2000. Long-term prevention of renal insufficiency, excess matrix gene expression, and glomerular mesangial matrix expansion by treatment with monoclonal antitransforming growth factor-beta antibody in db/db diabetic mice. Proc. Natl. Acad. Sci. U. S. A. 97, 8015-8020.

 Pterostilbene improves kidney coefficient and insulin signaling in renal cortex of fructose-fed rats and/or fructose-exposed HK-2 cells. Kidney coefficient (A) was determined (n = 7). Protein levels of p-IR (Tyr 1345) (B), p-IRS-1 (Tyr 896) (C) and p-Akt (Ser473) (D) in rat renal cortex were determined, respectively. Protein levels of p-IR (Tyr 1345) (E), p-IRS-1 (Tyr 896) (F) and p-Akt (Ser473) (G) in

fructose-exposed HK-2 cells were determined, respectively. Protein levels of p-Akt (Ser473) (H) in MK-2206 2HCl-treated HK-2 cells were determined. Protein levels of p-IR (Tyr 1345) (I) and p-Akt (Ser473) (J) in GSK1904529A-treated HK-2 cells were determined. Relative protein levels of p-IR (Tyr 1345), p-IRS-1 (Tyr 896) and p-Akt (Ser473) were determined by Western blot analysis, normalized to IR, IRS-1 or Akt, and quantified by Image J (n = 7), respectively. Data are expressed as mean ± S.E.M..

**P < 0.01, ***P < 0.001 vs normal control group. #P < 0.05, ##P < 0.01, ###P < 0.001 vs fructose-vehicle group.

 Pterostilbene attenuates renal cortex fibrosis, EMT and collagen deposition in fructose-fed rats and/or fructose-exposed HK-2 cells. Serum hyaluronic acid (A) and TGF-β1 (B) levels were determined (n = 6), respectively. Histology of renal cortex sections in rats were examined by masson staining (C). Representative immunohistochemical images of proximal tubule stained with E-cadherin and α-SMA (C). Protein levels of E-cadherin (D) and α-SMA (E) in renal cortex were determined. Collagen III protein (F) and mRNA (G) levels in renal cortex were determined.

Representative photomicrographs (H) imaged by inverted phase-contrast microscopy showed morphologic changes in fructose-exposed HK-2 cells. α-SMA protein levels

(I) in fructose-exposed HK-2 cells were detected. Collagen III protein (J) and mRNA

 

(K) levels in HK-2 cells were determined. Relative protein levels of collagen III and α-SMA were detected by Western blot analysis, normalized to β-actin, and quantified by Image J (n = 7), respectively. Relative collagen III mRNA levels were determined

 

 

by qRT-PCR analysis, normalized to β-actin (n = 5). Data are expressed as mean ± S.E.M.. **P < 0.01, ***P < 0.001 vs normal control group. #P < 0.05, ##P < 0.01, ###P <

0.001 vs fructose-vehicle group.

 Pterostilbene suppresses TGF-β1/TGF-β type I receptor/Smads signaling activation in fructose-fed rats and fructose-exposed HK-2 cells. Protein levels of TGF-β1 (A) and TGF-β type I receptor (B) in rat renal cortex were determined, respectively. TGF-β type I receptor (C) mRNA levels in rat renal cortex were determined. Protein levels of TGF-β type II receptor (D), p-Smad2 (E), p-Smad3 (F)and Smad4 (G) in rat renal cortex were determined, respectively. Smad4 mRNA levels(H) in rat renal cortex were determined. Protein levels of TGF-β1 (I) infructose-exposed HK-2 cells were detected. Culture supernatant TGF-β1 levels (J)were determined (n = 6). Protein levels of TGF-β type I receptor (K), TGF-β type II receptor (L), p-Smad2 (M), p-Smad3 (N) and Smad4 (O) in fructose-exposed HK-2 cells were detected, respectively. Relative mRNA levels of TGF-β type I receptor and Smad4 were determined by qRT-PCR analysis, normalized to β-actin (n = 5), respectively. Relative protein levels of p-Smad2, p-Smad3, TGF-β1, TGF-β type I receptor, TGF-β type II receptor and Smad4 were determined by Western blot analysis, normalized to Smad2, Smad3 or β-actin, and quantified by Image J (n = 7), respectively. Data are expressed as mean ± S.E.M.. *P < 0.05, **P < 0.01, ***P < 0.001 vs normal control group. #P < 0.05, ##P < 0.01, ###P < 0.001 vs fructose-vehicle group.

 Pterostilbene attenuates EMT and collagen deposition by inhibiting TGF-β1/TGF-β type I receptor/Smads signaling activation in vivo and in vitro.Immunostaining of TGF-β1 and TGF-β type I receptor in renal cortex of fructose-fed rats were detected (A) (scale bar, 50 μm). Quantitative immunofluorescence of

TGF-β1 (B) and TGF-β type I receptor (C) staining were calculated using Image J analysis software. Nucleus protein levels of Smad4 (D) were assayed in renal cortex of fructose-fed rats. Protein levels of TGF-β type I receptor (E) were assayed in SD208-treated HK-2 cells. Protein levels of p-Smad2 (F), p-Smad3 (G), Smad4 (H),

E-cadherin (I), α-SMA (J) and collagen III (K) in SD208 and fructose co-treated HK-2 cells were assayed. Protein levels of p-Smad2 (L), p-Smad3 (M) and Smad4 (N) in LY2109761-treated HK-2 cells were assayed. Relative protein levels of p-Smad2,

p-Smad3, TGF-β type I receptor, Smad4, collagen III, E-cadherin and α-SMA were determined by Western blot analysis, normalized to Smad2, Smad3 or β-actin, and quantified by Image J (n = 7), respectively. Data are expressed as mean ± S.E.M.. *P < 0.05, **P < 0.01, ***P < 0.001 versus normal control group. #P < 0.05, ###P < 0.001 versus fructose-vehicle group.

Table 1. Effects of pterostilbene and pirfenidone on serum insulin, TG and TC levels in fructose-fed rats. The data are expressed as mean ± S.E.M., n = 7. a<0.001 vs normal control group, b<0.01, c<0.001 vs fructose-vehicle group.

Group

Dose

Serum insulin

Serum TG

Serum TC

(mg/kg)

(ng/mL)

(mg/dL)

(mg/dL)

Normal control

-

1.95 ± 0.09

78.69 ±3.05

76.47 ± 2.29

Fructose

Vehicle

3.32 ± 0.12a

154.10 ±8.86a

121.20 ± 5.46a

Pterostilbene

10

2.66 ± 0.09c

112.00 ± 2.30b

88.19 ± 5.64c20

2.29 ± 0.07c

99.04 ± 12.13c

73.52 ± 6.17c40

2.01 ± 0.07c

101.30 ± 4.01c

67.37 ± 4.04c

Pirfenidone

200

3.23 ± 0.10a

161.30 ± 10.15a

116.70 ± 3.39a