Osteoporos Int 19:1395–1408PubMedCrossRef 90. Kanis JA, Reginster JY (2008) European guidance for the diagnosis and management of osteoporosis in postmenopausal women—what is the current message for clinical practice? Pol Arch Med Wewn 118:538–540PubMed 91. NOF (2003) Physician’s guide to prevention and treatment of osteoporosis. NOF, Washington DC 92. EC (1998) Report on osteoporosis

in the European Community. EC, Strasbourg 93. Brixen K (2002) Consensus report on osteoporosis. Ugeskr Laeger Suppl. 10 94. Hellenic Foundation for Osteoporosis (2004) Kateufunthries gpammes gia th diagnwsh kai antimetwpisnh ths Osteopowshs sthn Ellada (Guidelines for diagnosis and management of osteoporosis in Greece). Athens 95. Collegio dei Reumatologi find more Ospedalieri, Società Italiana dell’Osteoporosi e delle Malattie del Metabolismo Minerale e Scheletrico,

Società Italiana di Medicina Fisica e Riabilitativa, Società Italiana di Medicina Interna, Società ALK inhibitor Italiana di Ortopedia e Traumatologia, Società Italiana di Radiologia Medica, Società Italiana di Reumatologia (2006) Linee guida per la diagnosi, prevenzione e terapia dell’osteoporosi (Guidelines for the diagnosis, prevention and treatment of osteoporosis). SINOSSI. EDIMES., Pavia 96. Pols HA, Wittenberg J (2002) CBO guideline ‘Osteoporosis’ (second revision]. Ned Tijdschr Geneeskd 146:1359–1363PubMed 97. SEIOMM (2003) Amrubicin Guía de Práctica: osteoporosis posmenopáusica (Practice guidelines: postmenopausal osteoporosis). Revista Clinica Española. pp 496–506 98. SIGN

(2003) Management of osteoporosis. SIGN, Edinburgh 99. Dawson-Hughes B (2008) A revised clinician’s guide to the prevention and treatment of osteoporosis. J Clin Endocrinol Metab 93:2463–2465PubMedCrossRef 100. Kanis JA, Johnell O (2005) Requirements for DXA for the management of osteoporosis in Europe. Osteoporos Int 16:229–238PubMedCrossRef 101. Association Suisse contre l‘Ostéoporose (2010) Ostéoporose: Recommandations 2010. ASCO. http://​www.​svgo.​ch/​content/​documents/​SVGO_​Empfehlungen2010​_​V19April2010.​pdf. Accessed May 2012 102. Compston J, Cooper A, Cooper C, Francis R, Kanis JA, Marsh D, McCloskey EV, Reid DM, Selby P, Wilkins M (2009) Guidelines for the diagnosis and management of osteoporosis in postmenopausal women and men from the age of 50 years in the UK. Maturitas 62:105–108PubMedCrossRef 103. Czerwinski E, Kanis JA, Trybulec B, Johansson H, Borowy P, Osieleniec J (2009) The incidence and risk of hip fracture in Poland. Osteoporos Int 20:1363–1367PubMedCrossRef 104. Badurski JE, Kanis JA, Johansson H, Dobrenko A, Nowak NA, Daniluk S, Jezienicka E (2011) The application of FRAX® to determine intervention thresholds in osteoporosis treatment in Poland. Pol Arch Med Wewn 121:148–155PubMed 105.

5. 2011. 25. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S,

Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens Everolimus solubility dmso R, Vassieva O, Vonstein V, Wilke A, Zagnitko O: The RAST Server: Rapid Annotations using Subsystems Technology. BMC Genomics 2008, 9:75.PubMedCrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions RBD and WLS designed the study. RBD performed the analyses and wrote the manuscript. Both RBD and WLS have approved the final manuscript.”
“Background From a physiological point of view, metals fall into three main categories, namely essential and non-toxic (e.g. Ca2+ and Mg2+); essential, but harmful at high concentrations (e.g. Fe2+, Mn2+, Zn2+, Cu2+, Co2+, Ni2+ and Mo2+), and toxic (e.g. Hg2+ or Cd2+) [1]. However, at high concentrations, both essential and find more nonessential metals can be harmful to the cell, damaging the cell membrane, the structure of DNA, or changing the specificity of enzymes [2–4]. The microorganisms have developed homeostasis systems in order to maintain

an optimal intracellular concentration of metals. This is achieved through controlling the processes of transport, intracellular trafficking, efflux and conservation, ensuring its bioavailability to cellular processes and preventing damage to cellular components

[5]. Studies support a role for horizontal gene transfer (HGT) in the evolution of metal homeostasis in Proteobacteria, along with the identification of putative genomic islands (GIs), with examples in Cupriavidus metallidurans, Pseudomonas putida KT2440 and Comamonas testosteroni S44 [6–9]. In fact, many microorganisms have genes located on chromosomes, plasmids, or transposons encoding specific traits conferring resistance to a variety of metal ions [3]. Efflux is one of the main approaches used by bacteria to control internal metal ion concentrations, and several efflux systems have been described in bacteria. The P-type ATPases use ATP hydrolysis to promote ion transport and have been identified in efflux of both mono- and divalent cations from the cytoplasm [10–13]. The Cation Diffusion Facilitator (CDF) are chemiosmotic ion/proton exchangers Cell Cycle inhibitor that present six transmembrane helices and are involved in the efflux of divalent metal cations [11, 14, 15]. In Gram-negative bacteria, the Resistance-Nodulation-Division superfamily (RND) includes systems that confer resistance to antibiotics and metals, and it is composed of a tripartite protein complex: an RND protein, located in the cytoplasmic membrane, a periplasmic membrane fusion protein (MFP) and an outer-membrane channel protein (OMP) [16–18]. These components form a channel that spans both membranes and the periplasmic space [18–21].

1-C.1). The addition of MgATP to the OppA mutants led to an increase in ATPase activity in a dose-dependent and saturable manner. The data of ATP hydrolysis were fed into Michaelis-Menten

equation. In nonlinear regression analysis the Michaelis constant, Km for the recombinant OppAR was 0.46 ± 0.04 mM ATP, whereas Km for the wild type selleck compound OppAWT was 0.18 ± 0.04 mM. As the Michaelis constant behaves reciprocally to the enzyme affinity this exhibits a higher affinity of OppAWT for ATP than OppAR. This may be due to a partial misfolding of the recombinant variant. However, the maximum reaction rate (Vmax 1543 ± 32.54 nmol/min/mg) was similar for both proteins. Figure 2 ATPase activity and adhesion of M. hominis membrane proteins P50, P60/P80 and OppA variants. ATPase activities of purified proteins (0.5 μg/well) were measured in the ammonium molybdate assay as a function of ATP concentration [A.1-C.1] Protein adhesion to HeLa cells was measured in cell-ELISA [A.2-C.2]. A comparison of the relative ATPase activity selleck inhibitor (black bars) and adhesion (striped bars) with regard to wild type OppA is shown in [A.3-C.3]. Data represent means of three independent experiments with triplicate samples in each experiment. Statistical analysis was performed by unpaired t-test and statistically significant results designated

by *. *P < 0.05, **P < 0.01, and ***P < 0.001. The ATPase activity or adhesion of the OppA mutants were compared with those of the recombinant OppA (R). As shown in Figure 2A.1 dephosphorylation of OppA had no influence on Meloxicam its ATPase activity (Km 0.39 ± 0.04 mM ATP) whereas mutations within either the Walker A or Walker B motifs led to a dramatic decrease in ATP-hydrolysis. As previously shown in 2004 [14] a single point mutation in the Walker A motif (K875R) led to a decreased ATP-hydrolysis by OppAWA1 to 15% whereas ATP-binding still occurred. Mutation of the whole Walker A motif in OppAWA2 resulted in the complete inhibition of both ATP-binding and hydrolysis. Exchanging the Walker A motif of M.

hominis with the putative Walker A sequence of M. pulmonis in OppAWA3 also led to inhibition of the ATP-hydrolysis indicating that the Walker A motif of M. pulmonis in this context is non-functional. As expected both the OppA-mutant lacking the Walker B motif (OppAΔWB) as well as the OppAN -mutant with a complete deletion of the C- terminal half of OppA, including the ATP-binding domain, did not show any ATPase activity (Figure 2C.1). Next we examined the contribution of the other conserved regions on the catalytic function of OppA. Deletion of the CS2 region (AA365-372) led to an increased Km in the OppAΔCS2mutant (2.56 ± 0.43 mM ATP) (Figure 2B.1). With regard to the OppAΔCs1 and OppAΔCs3 mutants the lowest affinity for ATP was observed for the OppAΔCs3 mutant (Km 2.86 ± 0.

Chem Rev 2010, 110:111.CrossRef 18. Jiles DC: Introduction to the Electronic Properties of Materials. London: Chapman and Hall; 1994.CrossRef 19. Ziegler E, Heinrich A, Oppermann H, Stover G: Electrical properties and nonstoichiometry in ZnO single crystals. Phys Status Solidi A 1981, 66:635.CrossRef 20. Burstein E: Anomalous optical absorption limit

in InSb. Phys Rev 1954, 93:632.CrossRef 21. Moss TS: The interpretation of the properties of indium antimonide. Proc Phys Soc Ser B 1954, 67:775.CrossRef 22. Park YR, Kim KJ: Optical and electrical properties of Ti-doped ZnO films: observation of semiconductor–metal transition. Solid State Commun 2002, 123:147.CrossRef selleck screening library 23. Paul GK, Bandyopadhyay S, Sen SK, Sen S: Structural, optical and electrical studies

on sol–gel deposited Zr doped ZnO films. Mater Chem Phys 2003, 79:71.CrossRef Competing interests The authors declare that they have no competing interests. Authors’ contributions The experiment was designed by ZYY and HLL and revised by QQS, SJD, and DWZ. The fabrication of TZO films was carried by ZYY and YG. The characteristics of the films were tested and analyzed by ZYY with the help from YG, YZG, ZYX, and YZ. ZYY prepared the manuscript, Everolimus and HLL gave a lot of help with the draft editing. All of the authors have read and approved the final manuscript.”
“Background The quest and demand for clean and economical energy sources have increased the interest in the development of solar applications. In particular,

direct conversion of solar energy to electrical energy using photovoltaic cells has attracted much attention for several decades [1–4]. Among various photovoltaic cells, organic polymer-based solar cells have received considerable attention as a new alternative ROS1 photovoltaic technology due to their flexibility, light weight, low-cost fabrication, and easy integration into a wide variety of devices [5]. Importantly, bulk heterojunction (BHJ) solar cells based on intimate blends of organic polymer as the donor and inorganic nanomaterials as the acceptor are currently attracting increasingly widespread scientific and technological interests because of the advantages, resulting from these two types of materials, such as low cost, outstanding chemical and physical properties, easy preparation from organic polymers, high electron mobility, excellent chemical and physical stabilities, size tunability, and complementary light absorption from inorganic semiconductors [6–8].

It was suspected already in the mid-1970s and the early 1980s, and confirmed by later systematic LD spectroscopic studies, that the pigment dipoles are aligned under well-defined orientation angles with respect to the main axes of the complexes and/or of the membrane planes, and that the non-random orientation of the pigment molecules is a universal

property: this holds true for virtually all the photosynthetic pigments and in all organisms (Clayton 1980; Breton and Verméglio 1982). CD spectroscopy has also been widely used since the early 1970s and 1980s, during which the basic BTK inhibitor features and the occurrence of excitonic interactions in virtually all pigment–protein complexes have been established (Pearlstein 1991). In the last two decades, LD and CD spectroscopies

have gradually matured to become quantitative tools, which provide important information on different pigment systems and different, often high, levels of complexity, also under physiologically relevant conditions. Two chapters in the earlier books (Van Amerongen and Struve 1995; Garab 1996) have provided a detailed description of LD and CD techniques and the main areas of applications, while the monograph on photosynthetic excitons (Van Amerongen et al. 2000) has provided the theoretical background necessary for the in-depth interpretation of short-range, excitonic interactions between see more pigment molecules. For more complex, highly organized systems, the CD theory of psi (polymer and salt-induced)-type aggregates should be used (Keller and Bustamante 1986; Tinoco et al. 1987). The purpose of this educational review is to provide an introduction to LD and CD spectroscopies, as well as to some related differential

polarization spectroscopy and microscopy techniques. We explain, in simple terms, the basic physical principles and demonstrate, via BCKDHB a few recent examples, the use of these tools in photosynthesis research. For a deeper understanding, readers are referred to the reviews and monographs cited above, and to articles quoted below in this review. For a basic understanding of the physical principles related to photosynthesis, see Clayton (1980). Transition dipole moments of photosynthetic pigment molecules The absorption of light at a given wavelength corresponds to the transition from an electronic ground state to a given excited state of the molecule. The transition dipole moment, μ, which is associated with the electronic transition can be envisaged as a two-headed vector. The transitions for most photosynthetic pigments and most absorbance bands can be assigned to well-defined orientations with respect to the molecular coordinate system (see supplemental Fig. S1). (However, for some absorbance transitions, e.g.

PubMed 100. Nagle A, Ujiki M, Denham W, Murayama K: Laparoscopic adhesiolysis for small bowel obstruction. Am J Surg 2004,187(4):464–70.PubMed 101. Swank DJ, Swank-Bordewijk SC, Hop WC, van Erp WF, Janssen IM, Bonjer HJ, Jeekel J: Laparoscopic ZD1839 supplier adhesiolysis in patients with chronic abdominal pain: a blinded randomised controlled

multi-centre trial. Lancet 2003,361(9365):1247–51.PubMed 102. Cirocchi R, Abraha I, Farinella E, Montedori A, Sciannameo F: Laparoscopic versus open surgery in small bowel obstruction. Cochrane Database Syst Rev 2010,17(2):CD007511. Review 103. Ray NF, Denton WG, Thamer M, Henderson SC, Perry S: Abdominal adhesiolysis: inpatient care and expenditures in the United States in 1994. J Am Coll Surg 1998, 186:1–9.PubMed 104. Suter M, Zermatten P, Hakic N, et al.: Laparoscopic management of mechanical small bowel obstruction: are there predictors of success or Pexidartinib ic50 failure? Surg Endosc 2000, 14:478–484.PubMed 105. León EL, Metzger A, Tsiotos GG, et al.: Laparoscopic management of small bowel obstruction: indications and outcomes. J Gastrointest Surg 1998, 2:132–140.PubMed 106. Navez B, Arimont JM, Guit P:

Laparoscopic approach in acute small bowel obstruction. A review of 68 patients. Hepatogastroenterology 1998, 45:2146–2150.PubMed 107. Suter M, Zermatten P, Hakic N, et al.: Laparoscopic management of mechanical small bowel obstruction: are there predictors of success or failure? Surg Endosc 2000, 14:478–484.PubMed 108. Pekmezci S, Altinli E, Saribeyoglu K, et al.: Enteroclysis-guided laparoscopic adhesiolysis in recurrent adhesive small bowel obstructions. Surg Laparosc Endosc Percutan Tech 2001, 12:165–170. 109. Leon EL, Metzger A, Tsiotos GG, Schlinkert RT, Sarr MG: Laparoscopic management of acute small bowel obstruction: indications and outcome. J Gastrointest Surg 1998, 2:132–40.PubMed 110. Wang Q, Hu ZQ, Wang WJ, Zhang J, Wang Y, Ruan CP: Laparoscopic management of recurrent adhesive small-bowel obstruction: Long-term follow-up. Surg Today 2009,39(6):493–9.PubMed

111. Navez B, Arimont JM, Guit P: Laparoscopic approach in acute small bowel obstruction. A review of 68 patients. Hepatogastroenterology 1998, 45:2146–2150.PubMed Protein tyrosine phosphatase 112. Van Goor H: Consequences and complications of peritoneal adhesions. Colorectal Dis 2007,9(Suppl 2):25–34.PubMed 113. Sato Y, Ido K, Kumagai M, et al.: Laparoscopic adhesiolysis for recurrent small bowel obstruction: long-term follow-up. Gastrointest Endosc 2001, 54:476–479.PubMed 114. Chosidow D, Johanet H, Montario T, et al.: Laparoscopy for acute small-bowel obstruction secondary to adhesions. J Laparoendosc Adv Surg Tech 2000, 10:155–159. 115. Sato Y, Ido K, Kumagai M, et al.: Laparoscopic adhesiolysis for recurrent small bowel obstruction: long-term follow-up. Gastrointest Endosc 2001, 54:476–479.PubMed 116. Farinella E, Cirocchi R, La Mura F, Morelli U, Cattorini L, Delmonaco P, Migliaccio C, De Sol AA, Cozzaglio L: Sciannameo F Feasibility of laparoscopy for small bowel obstruction.

E. coli strains were grown at 37°C, P. luminescens TT01 and its derivatives at 28°C and P. asymbiotica at both temperatures depending on the assay. For pellicle assays [34] and biofilm in microscopy chambers (Ibidi) strains were grown statically in LB and Grace’s/Schneider’s insect media (Sigma). Amplification of the s1 gene from P. asymbiotica isolates was performed using the primers s1F: 5′TATGAATTCATAAGTAAGGAT 3′ and s1R: 5′ CGGTGTTTTAGTAAGCTTCTATCT 3′. Two-dimensional

gel electrophoresis, Western blot and Pam protein purification From a starting overnight culture (28°C) of P. asymbiotica ATCC43949, cultures were inoculated and grown for 24 h at 28°C and 37°C until early stationary phase. Proteins from both supernatants were phenol precipitated and resuspended in 150 μl CDU buffer (4% CHAPS, 130 mM DTT and 9 M Urea) containing LEE011 nmr 1 × HALTTM protease Inhibitor Cocktail Mix (Pierce, Thermo Fisher, UK). Samples Talazoparib molecular weight were incubated for 2 h at room temperature, then centrifuged for 30 min at 88 760 × g. The RediPlate Protein Quantitation Kit (Molecular Probes, Invitrogen, UK) was used to

quantify protein concentration in the samples and equivalent amounts of total proteins were loaded. A Multiphor II system (GE Healthcare, UK) was used for isoelectric focusing and horizontal SDS-polyacrylamide gel electrophoresis with Immobiline DryStrip gels and precast 12.5% SDS gels (GE Healthcare, UK), following the manufacturer’s instructions. Gels were Coomassie stained and protein spots were excised and sent to the protein sequencing facility at the University of the West of England (Bristol, UK). The peptide sequences resulting from MALDI analysis of trypsin-digested proteins, were compared to all proteins in the SwissProt non-redundant database and to a database of

predicted proteins from the P. asymbiotica ATCC43949 genome sequence [8]. A polyclonal anti-Pam antibody was raised in rabbits against the peptide KLIQDSIRLDQGEW (amino acid positions 28-41) from P. asymbiotica ATCC43949 by GenScript Corporation (USA). For Western blot, proteins were precipitated with 1/10 triclocarban volumes of 100% Trichloroacetic acid, separated by SDS-PAGE and transferred onto a Trans-Blot nitrocellulose membrane (BioRad, USA) using a Semi-Dry blotter (BioRad, USA). Membranes were incubated with 1/500 dilution of the anti-Pam antibody for 90 min and with 1/5000 dilution of an anti-rabbit alkaline phosphatase conjugated secondary antibody for 90 min Alkaline phosphatase reaction with NBT-BCIP solution (Fluka, Sigma-Aldrich, USA) was used for development. To detect production of Pam in vivo, larvae of Galleria mellonella were injected with 20 μl of diluted overnight cultures of either P. luminescens TT01 or P. asymbiotica ATCC43949, corresponding to 200 CFU. Infected insects were collected on successive days and crushed in lysis buffer, containing 125 mM Tris pH 8.0, 4 M urea, 2% SDS, and 5% β-mercaptoethanol (1 ml per insect).

These attributes render mCV-N to be a promising microbicide candidate. In this proof-of-concept in-vitro model, the bioengineered L. jensenii did not differ from the wild type parental strain in term of epithelial colonization capacity and did not induce a pro-inflammatory profile in the human epithelial cell context. Thus, our in-vitro findings along with in-vivo studies performed in the murine and macaque model pave the way to further clinical safety evaluations necessary to confirm the effects these bacteria would have when introduced

selleckchem into the human cervicovaginal environment and how it would affect other endogenous microbiota in-vivo. There are many components that are unique to the human vaginal environment and therefore would be best investigated in-vivo i.e. indigenous bacterial biofilms, pH, mucosal immunoglobulins and

hormones, and vaginal practices that may modify the effects of both the bioengineered bacteria and the activity of mCV-N peptide. Conclusion Our in-vitro human vaginal colonization model produced consistent results, validated by their agreement with findings from the in-vivo macaque model. Because of its reproducibility and low cost, the in-vitro colonization model can be used for high throughput preclinical screening and side-by-side comparison of multiple bacterial strains, bioengineered derivatives and probiotic candidates to select those with best homeostatic properties. In support of our hypothesis, we were able to PD-1/PD-L1 inhibitor compare microbiota-epithelial interactions of multiple L. jensenii WT and bioengineered strains in a reproducible manner. The bioengineered L. jensenii derivatives were able to deliver a bioactive anti-HIV peptide without inducing cellular toxicity or alterations in levels of pro-inflammatory

cytokines and protective mucosal immune mediators e.g. SLPI or IL-1RA. Our pre-clinical safety data in combination with the results from the macaque model provide support for future clinical evaluations of the bioengineered L. jensenii bacteria as an anti-HIV microbicide. Acknowledgments The authors thank Y. Liu, L. Jia and X. Liu for performing the western blot and gp-120 assay. This work was supported by grant NIH-NIAID, 2R21AI071978 to Osel Inc (XQ) and subcontract to Brigham and Women’s Hospital (RNF). The development of the vaginal colonization Unoprostone model was first supported by a Connor’s Seed Grant for Gender Biology, Center for Women’s Health, Brigham and Women’s Hospital (RNF), NICHD R21HD054451 (RNF) and R01AI079085 (RNF). References 1. UNAIDS World Day Report 2011. [http://​www.​unaids.​org/​en/​media/​unaids/​contentassets/​documents/​unaidspublicatio​n/​2011/​JC2216_​WorldAIDSday_​report_​2011_​en.​pdf] 2. Van Damme L, Govinden R, Mirembe FM, Guedou F, Solomon S, Becker ML, Pradeep BS, Krishnan AK, Alary M, Pande B, et al.: Lack of effectiveness of cellulose sulfate gel for the prevention of vaginal HIV transmission. N Engl J Med 2008,359(5):463–472.PubMedCrossRef 3.

Beyond this fluence, ripples disappear and small mounds as well as faceted structures evolve (which grow further with increasing fluence) which is evident from Figures 4b,c,d,e,f. Figure 4 AFM images of silicon exposed to 500 eV argon ions at 72.5° incidence angle. At fluences of (a) 1 × 1017, (b) 2 × 1017, (c) 5 × 1017, (d) 10 × 1017, (e) 15 × 1017, and (f) 20 × 1017 ions cm-2,

respectively. The corresponding height scales for (a to f) are the following: 4, 3.6, 73.9, 85.9, 165.2, and 154.1 nm. For clarity, (a, b) have a scan size of 1 × 1 μm2, whereas (c to f) have a scan size of 2 × 2 μm2. Insets show Ivacaftor concentration the 2D autocorrelation functions for corresponding images. The insets of all the images shown in Figures 3 and 4 represent corresponding 2D autocorrelation functions. In Figure 3, ripple anisotropy is clearly observed at the fluence of 1 × 1017 ions cm-2, whereas the same in Figure 4 is evident up to the fluence of 2 × 1017 ions cm-2. The average values (calculated from the AFM images shown in Figures 3 and 4) of ripple wavelength, feature height,

and base width of mounds/facets are listed in Table 1 for different fluence values. An increasing trend in height and base CX-4945 width of mounds/facets is observed for both angles of incidence with increasing Ar ion fluence albeit the effect is more prominent at 72.5°. Table 1 Calculated values of ripple wavelength ( λ ), feature height ( h ), and base width Rucaparib manufacturer of mounds/facets Angle of incidence

Fluence (ions cm-2) λ (nm) Average feature height (nm) Average base width (nm) 70° 1 × 1017 34 2 – 2 × 1017 57 5 – 5 × 1017 – 16 131 10 × 1017 – 22 152 15 × 1017 – 30 199 20 × 1017 – 56 357 72.5° 1 × 1017 26 1 – 2 × 1017 27 2 – 5 × 1017 – 28 237 10 × 1017 – 50 363 15 × 1017 – 78 486   20 × 1017 – 90 525 To explain the transition from a rippled surface to faceted structures, we invoke the shadowing condition stated in Equation 2. Let us first consider the case of 70° and the fluence of 1 × 1017 ions cm-2 where the calculated value of 2πh 0/λ turns out to be 0.369, whereas tan(π/2 – θ) is 0.364. Thus, 2πh 0/λ is slightly above the limiting condition which indicates the shadowing effect to start playing a role at this fluence itself. In the case of 2 × 1017 ions cm-2, the shadowing effect becomes more prominent since 2πh 0/λ turns out to be 0.551. As a result, crests of the ripples should undergo more erosion compared to troughs, and hence, there is a likelihood of mounds/facets to evolve. This explains the observation of mounds at this fluence. Similar behaviour is observed in the case of 72.5°. For instance, in the case of 1 × 1017 ions cm-2, 2πh 0/λ equals to 0.242, while tan(π/2 – θ) turns out to be 0.315. Thus, the condition for no shadowing, i.e. tan(π/2 – θ) ≥ 2πh 0/λ gets satisfied here, and ripples are expected to be seen. The observation of sinusoidal ripples in Figure 4a supports this theoretical prediction.

A. Morton for critical review of the manuscript and E. Diakun for technical assistance. C.J. and R.Y. were supported by NSERC scholarships.

Electronic supplementary material Additional file 1: Alignment of rpoS gene sequences of Suc ++ mutants with parental strains. The alignment data show the location of mutations within the rpoS gene in the selected Suc++ mutants in comparison with parental strains. (PDF 349 KB) Additional file 2: Alignment of predicted RpoS protein sequences of Suc ++ mutants with parental strains. The protein alignment RGFP966 concentration data show the predicted mutant forms of RpoS resulting from the identified mutations in the rpoS gene of Suc++ mutants. (PDF 128 KB) References 1. Stoodley P, Sauer K, Davies DG, Costerton JW: Biofilms as complex differentiated communities. Annu Rev Microbiol 2002, 56:187–209.CrossRefPubMed 2. Davidson CJ, Surette MG: Individuality in bacteria. Annu Rev Genet 2008, 42:253–268.CrossRefPubMed 3. Wolf DM, Vazirani VV, Arkin AP: Diversity in times of adversity: probabilistic strategies in microbial survival games. J Theor Biol 2005, 234:227–253.CrossRefPubMed 4. Lederberg J, Iino T: Phase Variation in Salmonella.

Genetics 1956, 41:743–757.PubMed 5. Hallet B: Playing Dr Jekyll and Mr Hyde: combined mechanisms of phase variation in bacteria. Curr Opin Microbiol 2001, 4:570–581.CrossRefPubMed 6. Tolker-Nielsen T, Holmstrom K, Boe L, Molin S: Non-genetic population heterogeneity studied by in situ polymerase chain reaction. Mol Microbiol 1998, 27:1099–1105.CrossRefPubMed 7. Ozbudak EM, Thattai M, Kurtser I, Grossman selleck compound AD, van Oudenaarden A: Regulation

of noise in the expression of a single gene. Nat Genet 2002, 31:69–73.CrossRefPubMed selleck chemicals llc 8. Dong T, Joyce C, Schellhorn HE: The Role of RpoS in Bacterial Adaptation. Bacterial Physiology – A Molecular Approach (Edited by: Walid M El-Sharoud). Springer, Berlin, Germany 2008, 313–337. 9. Hengge-Aronis R: The general stress response in Escherichia coli. Bacterial stress response (Edited by: Storz G, Hengge-Aronis R). Washington, D.C.: ASM press 2000, 161–178. 10. Dong T, Kirchhof MG, Schellhorn HE: RpoS regulation of gene expression during exponential growth of Escherichia coli K12. Mol Genet Genomics 2008, 279:267–277.CrossRefPubMed 11. Lacour S, Landini P: SigmaS-dependent gene expression at the onset of stationary phase in Escherichia coli : function of sigmaS-dependent genes and identification of their promoter sequences. J Bacteriol 2004, 186:7186–7195.CrossRefPubMed 12. Patten CL, Kirchhof MG, Schertzberg MR, Morton RA, Schellhorn HE: Microarray analysis of RpoS-mediated gene expression in Escherichia coli K-12. Mol Genet Genomics 2004, 272:580–591.CrossRefPubMed 13. Weber H, Polen T, Heuveling J, Wendisch VF, Hengge R: Genome-wide analysis of the general stress response network in Escherichia coli : sigmaS-dependent genes, promoters, and sigma factor selectivity. J Bacteriol 2005, 187:1591–1603.CrossRefPubMed 14.