In addition, NO scavenging inhibited light-induced expression of PERIOD1 protein at circadian time 18 (i.e.

the time for light-induced phase advances). These findings demonstrate the role of extracellular NO communication within the SCN in the steady-state synchronization to LD cycles. “
“The observation of an action modulates motor cortical outputs in specific ways, in part through mediation of the mirror neuron system. Sometimes we infer a meaning to an observed action based on integration of the actual percept with memories. Here, we conducted a series of experiments in healthy adults to investigate whether such inferred meanings can also modulate motor cortical outputs in specific ways. We show that brief observation of a neutral stimulus mimicking a hand does not significantly modulate motor cortical excitability (Study 1) although, after prolonged exposure, it can lead to a relatively nonspecific modulation MAPK inhibitor SP600125 purchase (Study

2). However, when such a neutral stimulus is preceded by exposure to a hand stimulus, the latter appears to serve as a prime, perhaps enabling meaning to the neutral stimulus, which then modulates motor cortical excitability in accordance with mirror neuron-driving properties (Studies 2 and 3). Overall results suggest that a symbolic value ascribed to an otherwise neutral stimulus can modulate motor cortical outputs, revealing the influence of top-down inputs on the mirror neuron system. These findings indicate a novel aspect of the human mirror neuron system: an otherwise neutral stimulus can Rebamipide acquire specific mirror neuron-driving properties in the absence of a direct association between motor practice and perception. This significant malleability in the way that the mirror neuron system can code otherwise meaningless (i.e. arbitrarily associated) stimuli may contribute to coding communicative signals such as language. This may represent a mirror neuron system feature that is unique to humans. “
“A recent clinical study demonstrated that damage to the insular cortex can disrupt tobacco addiction. The neurobiological mechanisms for this effect are not yet understood. In this study we used

an animal model of nicotine addiction to examine the possibility that changes in insular cortex levels of dopamine (DA)- and cAMP-regulated phosphoprotein of 32 kDa (DARPP-32), a phosphoprotein enriched in DA neurons containing DA D1 receptors, may be associated with changes in vulnerability to nicotine addiction. Once rats acquired self-administration, they were given unlimited access to nicotine (0.01 mg/kg/infusion) for 23 h/day for a total of 10 days. Each infusion was paired with a visual cue (stimulus light) and auditory cue (sound of pump). Nicotine seeking, as assessed under a cue-induced reinstatement paradigm, and markers of DARPP-32 signaling, as assessed using western blot analysis, were examined in separate groups of rats at two different abstinent intervals: 1 and 7 days.

The amount of ethylene produced AG-014699 molecular weight in early samples was similar in cultures with or without C10-HSL but, interestingly, a progressively decreased ethylene production was observed in the C10-HSL-treated culture, resulting in a 30% decrease of nitrogenase activity (data not shown). The progressive increase of the inhibitory effect of AHLs in acclimated cultures could perhaps be caused by the entry of the AHLs in the new generations of heterocysts, as the impermeability of the wall of mature heterocysts could prevent the penetration of the AHLs. Nonetheless it cannot be excluded that although AHLs

could enter through vegetative walls and spread along the filaments by the periplasmic space (Flores et al., 2006; Mariscal et al., 2007), entering in both mature and forming heterocysts, these molecules could only act at the molecular level in newly formed heterocysts. In that case the results observed would suggest a nonreversible inhibition of nitrogenase in very early stages at the level of either gene expression or its enzymatic activity. Because all tested AHLs showed inhibitory activity DZNeP price on nitrogen fixation mostly in newly formed heterocysts, to study possible effects at the level of expression of nitrogen metabolism genes, Northern blots were carried out to detect changes in expression of the dinitrogenase reductase

subunit gene (nifH) and fdxH, encoding a heterocyst-specific ferrodoxin that is a likely electron donor to dinitrogenase reductase (Razquin et al., 1995). No significant differences in the expression of either gene could be detected at 20 and 24 h after nitrogen step-down (no expression of nifH and fdxH

was detected at 0, 3 or 6 h) in total RNA extracted from C10-HSL-treated cultures when compared with control samples (Fig. 4). This indicates that the process of heterocyst differentiation proceeds normally in the presence of AHLs and therefore AHL inhibition could be affecting either the expression of other genes related to nitrogen fixation or be acting on nitrogenase-related genes at a post-transcriptional level. Finally, the strong inhibition of nitrogenase demonstrated for second all the AHLs tested and the cytotoxic effect of OC10-HSL in the presence of combined nitrogen represent novel biological activities of these signal molecules. The observation that antibiotics cannot easily reach the lethal concentrations in natural environments has led to a questioning of whether these molecules could act, in subinhibitory concentrations, as signal molecules (Davies, 2006; Linares et al., 2006). Low concentrations of several antibiotics can alter expression patterns of bacteria without any effect on growth rate (Davies et al., 2006), which resembles the mode of action of QS signals.

“
“It was once thought possible that the brain clock, located in the suprachiasmatic nucleus (SCN) of the hypothalamus, could be understood as a homogeneous population of cells that produced a synchronous daily oscillatory signal. Instead, it is now clear that SCN subregions exhibit orderly phase dispersal. The mechanisms enforcing regional phase differences, however, are not well understood. Hong et al. (in press) propose that calcium contributes to synchronization

through two mechanisms Selleckchem PLX4032 acting over different time scales and distances. Using all possible oscillating cell pairs as data points, the plot of temporal phase difference against pair separation ERK inhibitor chemical structure distance suggests the coexistence of two modes of signaling: progressively propagating waves of a diffusing signal in adjacent cells, and phase-synchronizing neural networks acting at long range. In the first, a sharp wedge-shaped boundary in the region of small pair separation distances was inferred to represent a calcium wave sweeping through the SCN. The slope of this boundary represents the travel

velocity of the wave, which, by itself, was calculated to be too slow to pass through the SCN in 24 h. A second mode of signaling was indicated by the finding that some cell pairs showed large spatial separations but nevertheless had small phase differences. For these cell pairs, the Fluorescence Resonance Energy Transfer signal was sufficiently bright to illuminate for cell processes, revealing that anatomically joined cells oscillated in phase. How does the fast, long-distance mechanism work? Ca2+(and/or other diffusing ions or molecules) could flow from one cell to another through gap junctions (Long et al., 2005), in addition to modulating the rate of neurotransmitter release. The slow Ca2+wave presumably indicates time-dependent release from Ca2+stores,

with the usual long list of Ca2+-dependent metabotropic pathways, including gene activation, coming into play. The data of Long et al. (2005) are consistent with substantial evidence highlighting the importance of calcium and cAMP production acting through cAMP-dependent transcription factors upon which clock gene expression and SCN synchronization depend (O’Neill & Reddy, 2012). In the shell region of the SCN, there is an orderly daily sequence of high-amplitude oscillations, which begins in the dorsomedial region and encompasses serial activation of specific SCN subregions, followed by a silent interval (Yamaguchi et al., 2003; Foley et al., 2011). RGS16, a modulator of G protein signaling, which inactivates a negative regulator of cAMP production, is first expressed in the dorsomedial region (Doi et al., 2011).

The broccoli was purchased at a local market in Seoul, Korea. The broccoli was shade dried and milled to a fine powder. Powdered samples of 50 g were extracted using 1000 mL of distilled water at 4 °C for 12 h. The extract was freeze-dried and the dried pellet weighed ∼7 g. The pellet was then dissolved again in 100 mL of distilled water, sterilized by filtration through BIBF 1120 in vivo a 0.22 μm membrane filter and stored at −20 °C for further experiments. For the AI-2 analysis, bacterial supernatants were assayed as described previously (Surette & Bassler, 1998). In brief, the bacteria were grown in LB broth containing 0.5% (w/v) glucose with varying concentrations of BE (from 0% to

5%). AI-2 production was detected via a V. harveyi AI-2 bioassay using culture supernatants harvested at 2 h postinoculation. The AI-2 level was expressed as a value relative to the AI-2 value of the supernatant from the culture of E. coli O157:H7 grown without BE. The level of violacein produced by CV026 was assessed as described previously (McClean et al., 1997). A swarming motility assay was performed as described elsewhere click here (Gonzalez

Barrios et al., 2006). Briefly, 20 μL of E. coli O157:H7 cultures grown overnight were mixed with the same volume of BE solutions to yield final BE concentrations of 0%, 0.25%, 0.5%, 2.5% and 5%. Then, LB agar plates were spot inoculated with 5 μL of each mixture. After incubation for 11 h at 30 °C, the soft agar (0.3%) plates that showed bacterial growth halos were scanned for image analysis. qRT-PCR analysis was performed as described previously (Yoon et al., 2011). The primer sequences are listed in Table 1 and a transcriptional level of rrsD gene encoding a ribosomal protein was used for normalization. A DNA fragment containing the promoter of ler in E. coli O157:H7 was amplified using specific oligonucleotides, PlerF (AGCGCGAGCTCTTAGAGATACTGGCTTTC AGG, SacI recognition learn more site underlined) and PlerR (AGGCCGGATCCTTTAATATTTT AAGCTATTAGCGAC, BamHI recognition

site underlined), and then digested with SacI and BamHI, and cloned into the SacI and BamHI sites of pAD123, yielding transcriptional fusion with gfp. The Pler–GFP fusion plasmid, pLER-GFP, was used to measure the promoter activity of ler. Escherichia coli O157:H7 was transformed with pLER-GFP or pAD123 (control) by electroporation. The transformed E. coli strains were inoculated into LB broth and grown overnight at 37 °C. The cultures were diluted to 1 : 100 in Dulbecco’s modified Eagle’s medium (DMEM) containing norepinephrine (50 μM) with or without BE (2.5%, v/v) and then incubated at 37 °C for 6 h. Green fluorescence intensity of each culture was measured using a Victor™ X4 multilabel counter (Perkin Elmer Life and Analytical Sciences, Waltham, MA). The germ line-defective and temperature-sensitive C.

“
“Brucella melitensis is a facultative intracellular pathogen that mainly resides within macrophages. The mechanisms employed by Brucella to adapt to harsh intracellular environments and survive within host macrophages are not clearly understood. Here, we constructed a cspA gene deletion mutant, NIΔcspA, that did not exhibit any discernible growth defect at a normal culture temperature (37 °C) or at a low temperature (15 °C). However, expression

of the cspA gene in Brucella was induced by cold, acidic, and selleck screening library oxidative conditions, as determined via quantitative reverse transcription PCR. Unlike its parental strain, B. melitensis NI, the NIΔcspA mutant showed an increased sensitivity to acidic and H2O2 stresses, especially during the mid-log-phase, and these stress conditions would presumably be encountered by bacteria during intracellular infections. Moreover, macrophage and mouse infection assays indicated that the NIΔcspA mutant fails to replicate in cultured J774.A1 murine macrophages and is rapidly cleared from the spleens of experimentally infected BALB/c mice. These findings suggest that the Brucella cspA gene makes an essential contribution to virulence in vitro and in vivo, most likely by allowing brucellae to adapt appropriately to the harsh environmental conditions

encountered within host macrophages. “
“This study investigated inactivation of bacteria SGI-1776 with ultraviolet light A irradiation in combination with vitamin K3

as a photosensitizer. Six bacteria including Bacillus cereus, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumoniae, and Escherichia coli suspended in vitamin K3 aqueous solution were exposed to ultraviolet light A. Five of six bacteria, with the exception of Pseudomonas aeruginosa, were reduced by eight logs with 1600 μM of vitamin K3 and 5.8 J cm−2 UV-A irradiation. Pseudomonas aeruginosa was reduced by four logs under these conditions. Reactive oxygen species including cAMP singlet oxygen, hydroxyl radical and superoxide anion radical were generated in vitamin K3 aqueous solution under UV-A irradiation. These results suggest that vitamin K3 and UV-A irradiation may be effective for bacterial inactivation in environmental and medical applications. “
“A previous multidisciplinary study indicated that gliotoxin-producing Aspergillus fumigatus Fresen. isolates from silage commodities mostly belonged to its variant A. fumigatus var. ellipticus Raper & Fennell. Sequence analysis revealed the presence of a single nucleotide polymorphism at five positions in a fragment of the rodA gene (coding for a hydrophobin rodletA protein) between Aspergillus fumigatus var. fumigatus and Aspergillus fumigatus var. ellipticus.

“
“Brucella melitensis is a facultative intracellular pathogen that mainly resides within macrophages. The mechanisms employed by Brucella to adapt to harsh intracellular environments and survive within host macrophages are not clearly understood. Here, we constructed a cspA gene deletion mutant, NIΔcspA, that did not exhibit any discernible growth defect at a normal culture temperature (37 °C) or at a low temperature (15 °C). However, expression

of the cspA gene in Brucella was induced by cold, acidic, and click here oxidative conditions, as determined via quantitative reverse transcription PCR. Unlike its parental strain, B. melitensis NI, the NIΔcspA mutant showed an increased sensitivity to acidic and H2O2 stresses, especially during the mid-log-phase, and these stress conditions would presumably be encountered by bacteria during intracellular infections. Moreover, macrophage and mouse infection assays indicated that the NIΔcspA mutant fails to replicate in cultured J774.A1 murine macrophages and is rapidly cleared from the spleens of experimentally infected BALB/c mice. These findings suggest that the Brucella cspA gene makes an essential contribution to virulence in vitro and in vivo, most likely by allowing brucellae to adapt appropriately to the harsh environmental conditions

encountered within host macrophages. “
“This study investigated inactivation of bacteria Selleckchem Trichostatin A with ultraviolet light A irradiation in combination with vitamin K3

as a photosensitizer. Six bacteria including Bacillus cereus, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Klebsiella pneumoniae, and Escherichia coli suspended in vitamin K3 aqueous solution were exposed to ultraviolet light A. Five of six bacteria, with the exception of Pseudomonas aeruginosa, were reduced by eight logs with 1600 μM of vitamin K3 and 5.8 J cm−2 UV-A irradiation. Pseudomonas aeruginosa was reduced by four logs under these conditions. Reactive oxygen species including Ribonuclease T1 singlet oxygen, hydroxyl radical and superoxide anion radical were generated in vitamin K3 aqueous solution under UV-A irradiation. These results suggest that vitamin K3 and UV-A irradiation may be effective for bacterial inactivation in environmental and medical applications. “
“A previous multidisciplinary study indicated that gliotoxin-producing Aspergillus fumigatus Fresen. isolates from silage commodities mostly belonged to its variant A. fumigatus var. ellipticus Raper & Fennell. Sequence analysis revealed the presence of a single nucleotide polymorphism at five positions in a fragment of the rodA gene (coding for a hydrophobin rodletA protein) between Aspergillus fumigatus var. fumigatus and Aspergillus fumigatus var. ellipticus.

, 1998). The sequences

were analyzed for the presence of secretion signal sequences using SignalP (ver. 3.0; http://www.cbs.dtu.dk/services/SignalP/) with the hidden Markov model (Bendtsen et al., 2004) and for protein localization using Psort (ver. 1; http://psort.hgc.jp/form.html; Horton et al., 2007). Phylogenetic trees were constructed using mega (ver. 4; Tamura et al., 2007) with the neighbor-joining method and Poisson correction model. A comparison of synonymous and nonsynonymous nucleotide substitution rates is a LGK 974 useful approach for studying the mechanisms of DNA sequence evolution. The numbers of nonsynonymous and synonymous substitutions per site (dN and dS, respectively) and their ratio (dN/dS) are important indicators of selection pressure at the protein level; dN/dS values of <1, 1, and >1 imply stabilizing selection, neutral mutations, and diversifying Ibrutinib positive selection, respectively.

To examine positive selection pressure on dnaD, imp, and idpA of PoiBI, we used ClustalW (Thompson et al., 1994) to align the nucleotide sequences of dnaD, imp, and idpA of PoiBI and WX (Liefting & Kirkpatrick, 2003; GenBank Acc. No. AF533231). Alignments were adjusted manually, and dN/dS values were calculated as the overall average of the codon sites in each gene with Jukes-Cantor model of Nei-Gojobori method by mega (ver. 4; Tamura et al., 2007). A significant difference test for dN/dS was performed according to a previously described procedure (Messier & Stewart, 1997). For expression cloning, the entire imp gene from the Primelo Jingle Bells PoiBI isolate was PCR-amplified Glutathione peroxidase using primers impful-F and imp-R (Table S1), and a truncated form of the gene was PCR-amplified

using primers impout-F and imp-R (Table S1). The truncated gene was designed to encode an Imp derivative lacking the N-terminal transmembrane region. Similarly, the entire idpA gene from the Primelo Jingle Bells PoiBI isolate was PCR-amplified using primers idpAful-F and idpAful-R, and a truncated form of the gene idpA gene was PCR-amplified using primers idpAcent-F and idpAcent-R. The truncated gene was designed to encode an IdpA derivative lacking both transmembrane regions and containing only the hydrophilic domain. In addition, idpA gene fragments encoding the N- and C-terminal halves of the IdpA hydrophilic domain were amplified using the primer pairs idpAcent-F/idpA534-R and idpA532-F/idpAcent-R, respectively. A pET system (Novagen) was used to fuse histidine-tag (His-tag) and express the full-length and truncated Imp and IdpA proteins, as well as the IdpA hydrophilic fragments, in Escherichia coli. Each of the six PCR products described above was doubly digested with NdeI and XhoI and inserted into pET30a(+), thereby placing a His-tag at the C-terminus of the cloned fragments. The resulting constructs were transformed into E.

, 1998). The sequences

were analyzed for the presence of secretion signal sequences using SignalP (ver. 3.0; http://www.cbs.dtu.dk/services/SignalP/) with the hidden Markov model (Bendtsen et al., 2004) and for protein localization using Psort (ver. 1; http://psort.hgc.jp/form.html; Horton et al., 2007). Phylogenetic trees were constructed using mega (ver. 4; Tamura et al., 2007) with the neighbor-joining method and Poisson correction model. A comparison of synonymous and nonsynonymous nucleotide substitution rates is a Sotrastaurin in vitro useful approach for studying the mechanisms of DNA sequence evolution. The numbers of nonsynonymous and synonymous substitutions per site (dN and dS, respectively) and their ratio (dN/dS) are important indicators of selection pressure at the protein level; dN/dS values of <1, 1, and >1 imply stabilizing selection, neutral mutations, and diversifying ABT-263 in vivo positive selection, respectively.

To examine positive selection pressure on dnaD, imp, and idpA of PoiBI, we used ClustalW (Thompson et al., 1994) to align the nucleotide sequences of dnaD, imp, and idpA of PoiBI and WX (Liefting & Kirkpatrick, 2003; GenBank Acc. No. AF533231). Alignments were adjusted manually, and dN/dS values were calculated as the overall average of the codon sites in each gene with Jukes-Cantor model of Nei-Gojobori method by mega (ver. 4; Tamura et al., 2007). A significant difference test for dN/dS was performed according to a previously described procedure (Messier & Stewart, 1997). For expression cloning, the entire imp gene from the Primelo Jingle Bells PoiBI isolate was PCR-amplified learn more using primers impful-F and imp-R (Table S1), and a truncated form of the gene was PCR-amplified

using primers impout-F and imp-R (Table S1). The truncated gene was designed to encode an Imp derivative lacking the N-terminal transmembrane region. Similarly, the entire idpA gene from the Primelo Jingle Bells PoiBI isolate was PCR-amplified using primers idpAful-F and idpAful-R, and a truncated form of the gene idpA gene was PCR-amplified using primers idpAcent-F and idpAcent-R. The truncated gene was designed to encode an IdpA derivative lacking both transmembrane regions and containing only the hydrophilic domain. In addition, idpA gene fragments encoding the N- and C-terminal halves of the IdpA hydrophilic domain were amplified using the primer pairs idpAcent-F/idpA534-R and idpA532-F/idpAcent-R, respectively. A pET system (Novagen) was used to fuse histidine-tag (His-tag) and express the full-length and truncated Imp and IdpA proteins, as well as the IdpA hydrophilic fragments, in Escherichia coli. Each of the six PCR products described above was doubly digested with NdeI and XhoI and inserted into pET30a(+), thereby placing a His-tag at the C-terminus of the cloned fragments. The resulting constructs were transformed into E.

657, n = 36, P < 0.001). It was followed by a linear regression between the thermotolerance (Y) and the yield (X) as follows: Y = −0.5678X + 106.7 (R2 = 0.432,  = 0.416) (F1,34 = 25.9, P < 0.001). The levels of conidial thermotolerance did not affect their virulence against WFT (r = 0.242, n = 36, P = 0.155). In addition, colonies producing conidia with higher RDV had less conidial yield

(r = −798, n = 36, P < 0.001). This study was the first attempt to generate fungal colonies with enhanced thermotolerance. A thermotolerant colony, BbHet2, PD0332991 mouse was formed by pairing two B. bassiana isolates to induce possible hyphal fusion. BbHet2 was morphologically different from the original isolates, ERL1578 and ERL1576. BbHet2 conidia were darker as observed under the phase-contrast microscope and had similar levels of virulence against WFT to the original isolates. The conidial productivity of BbHet2 was slightly lower than those of the original isolates, although it had the fastest mycelial growth among them. These results suggest that heterokaryosis, recombination or something else happened during pairing http://www.selleckchem.com/products/3-methyladenine.html and cycling. It was realized that molecular analyses should be conducted to ensure that there was indeed an exchange of nuclear

materials relevant to the physiological changes and thus heterokaryons or recombinants were produced. However, this aspect was beyond the scope of this research. After the co-inoculation of the two isolates, fused hyphae could not be found without careful observation, possibly because of the low frequency of events (< 10 events per plate; 0.001%) in this work. Another explanation is that the tip extension rate of the two hyphae was so fast that possible fused hyphae were covered with other non-fused hyphae in 30 h of

incubation. This fast covering would disrupt any observation of the events in the inner portion of the paired culture of the two B. bassiana isolates. Continuous observation at 1-h intervals is recommended to detect possible hyphal fusion. Limitations were encountered when trying to determine whether the hyphae were internally participating in hyphal fusion in the middle of the colony. Efforts were made to define the event as an internal hyphal fusion by describing the involvement Sorafenib concentration of different hyphal morphologies. This could be validated by further DNA-based analyses (Molitor et al., 2009). In this work, each of the two original isolates was subcultured to investigate whether morphologically different colonies could be generated even in the non-paired cultures used as controls. Morphologically different colonies (BbHet1 and BbHet2), compared to the original isolates, were isolated by cycling of paired cultures. The most thermotolerant colony, BbHet2, had the fastest radial mycelial growth on the agar medium and formed sponge-like mycelial masses with yellowish conidia. These features were not observed in the original isolates.

Six reference lines were measured on the study cast: D + E space, arch width, arch length, intercanine width, intercanine length, and arch perimeter. For each participant, the D + E space of the contralateral intact primary molar served as a control. A paired t-test was used to compare the cast measurements between initial examination and 12-month follow-up. A t-test was used to compare D + E space changes with those of the control group. Results.  The D + E space of the extraction side after 12 months was significantly smaller than that of the control side (P < 0.05) and the initial D + E space (P < 0.05). A significantly

greater arch perimeter, intercanine width, and intercanine length were found after 12 months compared with the initial parameters. No significant differences were found, however, in arch width or arch length between the initial examination AZD2281 and the 12-month follow-up examination (P > 0.05). Conclusions.  The 12-month space changes in the maxillary dental arch after premature loss of a primary maxillary first molar consist mainly of distal drift of the primary canine toward the extraction site. Mesial movement of permanent molars or tilting of the primary molars did not occur. An increased arch dimension was found especially in the anterior segment (intercanine width and length). There is no need for the use of space maintainers from the results in this study

in cases of premature loss of a primary first molar. “
“International Journal of Paediatric Dentistry 2010; 20: 347–352

Aim.  To investigate the prevalence of dental Navitoclax chemical structure fluorosis in children who had participated in an oral health programme between the ages 2–5 years, including fluoride tablets from the age of 2 years. Design.  The study group consisted of 135 10- to 11-year-old children who had participated in the programme, including parent education, tooth-brushing instruction and prescribed fluoride tablets Carnitine dehydrogenase (0.25 mg NaF) (2–3 years: 1 tablet/day; 3–5 years: 2 tablets/day). The prevalence of dental fluorosis in the study group was compared with that in a nonintervention reference group consisting of 129 children of the same ages. The analysis was based on photos of the permanent maxillary front teeth using the Thylstrup & Fejerskov (TF) Index. Results.  No statistically significant difference in prevalence of dental fluorosis was seen between the two groups. Forty-three percent of the children in the study group and 38% in the reference group had fluorosis, the majority of a mild nature (TF-score 1). None had a TF score above 2. The pattern was the same after correction for parent reported intake of tablets at 3 and 5 years of age. Conclusion.  Introduction of fluoride tablets at the age of 2 years did not result in increased prevalence of dental fluorosis. “
“International Journal of Paediatric Dentistry 2012; 22: 92–99 Background.