We report here improvement in functional Fab expression into the E. coli periplasm as a result of its co-expression with FkpA lacking a signal sequence (cytFkpA). The secretion of active Fabs into the periplasm was higher when co-expressed with cytFkpA either on a separate vector under control of an l-arabinose-inducible promoter, or as part of a tricistronic message that includes the chaperone, Fd and light chains on a single plasmid. We also examined the effect of cytFkpA expression on selection of scFv or Fab candidates from large phage libraries and have demonstrated increased expression levels

and diversity of displayed antibodies targeting the selected antigens, resulting in selection of a larger number of functional, sequence-unique antibody fragments screening assay with slower dissociation

constants. XL1-Blue cells (recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)]) and TG1 cells (supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5 (rK-mK–) [F′ traD36 proAB lacIqZΔM15]) were purchased from Agilent (Santa Clara, CA). In order to generate the plasmids responsible for cytoplasmic expression of chaperones, the native signal sequences were excised from the genes encoding the chaperones FkpA (Swiss-Prot accession no. P65764) and Skp (Swiss-Prot Small molecule library accession no. P0AEU7). Chaperones were also allowed to express in the bacterial periplasm with their native signal sequences. To generate the plasmid constructs of the cytoplasmic or periplasmic versions of the chaperones Skp and FkpA, and the bicistronic Skp-FkpA, the chaperone gene fragments were amplified by PCR and then cloned into the plasmid vector pAR3 (ATCC accession no. 87026). The vector pAR3 (Perez-Perez and Gutierrez, 1995) contains the pBAD promoter and the cat gene which confers chloramphenicol antibiotic resistance.

This plasmid harbors the p15A origin of replication which is compatible with the origin ColE1 included in all the vectors co-expressing Fabs or scFvs in our experiments. Two different forward primers and one reverse primer were designed in order to amplify FkpA from XL-1Blue cells by PCR amplification with or without the N-acetylglucosamine-1-phosphate transferase native leader peptide. Similarly, two forward primers and one reverse primer were designed to amplify Skp from XL1Blue cells by PCR with or without its native signal sequence. To generate the chaperone plasmid constructs pAR3-FkpA and pAR3-Skp for periplasmic expression and pAR3-cytFkpA and pAR3-cytSkp for cytoplasmic expression, the products of the previous PCR reactions were used as templates for PCR re-amplification using forward primers to incorporate a BglII restriction site followed by the enhancer sequence GAATTCATTAAAGAGGAGAAATTAACT upstream from the chaperone encoding gene fragment. Reverse primers were used to incorporate the V5 tag sequence (GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACG) into pAR3-Skp and pAR3-cytSkp and the FLAG tag sequence (GACTACAAGGACGATGACGACAAG) into the pAR3-FkpA and pAR3-cytFkpA, followed by the restriction site HindIII.