The number of alleles and haploid genetic

diversity per l

The number of alleles and haploid genetic

diversity per locus ranged from 2 to 30, and 0.204 to 0.881, respectively (Table 1). In the clone-corrected data set, genotypic linkage disequilibrium was not detected by pairwise comparison of loci across the overall isolates (P > 0.01). Table 1 Characteristics of seven microsatellite markers developed from ‘Candidatus Liberibacter asiaticus’ SSR Markers Primer sequences (5′—–3′) Repeats Location in genome ORF T a (°C) Size range (bp) No. of alleles H LasSSR-A-f LasSSR-A-r FAM-CGCCTACAGGAATTTCGTTACG TCTCATCTTGTTGCTTCGTTTATCC (TATTCTG)8 255477-255753 adenosine deaminases 50°C 241-434 30 0.881 LasSSR-B-f LasSSR-B-r VIC-ATCGCCTATAAATCCCTTTACTGATATGTTTCC TGGTAACGGAAGTGATAATAACTACAGCAATAAG (TTTAA)6 669257-669458 hypothetical protein 60°C 196-206 3 0.216 LasSSR-C-f LasSSR-C-r VIC-CGATTGTTGATGAATTACC LY2109761 GAATAGAAGAACCCTAAGC (CAGT)8 666722-666947 phosphohydrolases 50°C 208-254 15 0.613 LasSSR-D-f LasSSR-D-r NED-CGGTGTCGGTATCGGTATCATTC

selleck inhibitor CGAAGAAGAGACGGAGGTTAAGC (TTC)5 377678-377850 hypothetical protein 55°C 158-174 3 0.391 LasSSR-E-f LasSSR-E-r NED-GATCAGTAGTCTATCACCAC TACTGGAAACAAATGGAATAC (CTTGTGT)5 354424-354613 transcriptional regulator 50°C 173-290 17 0.587 LasSSR-F-f LasSSR-F-r FAM-TCGTCTTATCGTATATCACTCC TTCACTATTAAAGGATCAAGGC (TTTACATC)3 520542-520307 repair ATPase 52°C 227-235 2 0.204 LasSSR-G-f LasSSR-G-r FAM-CGGGAGAAATTAAAGATGATGG CGCTGTTAATACATACTTACGC (TTGTTGGA)2 998251-998403 hypothetical protein 53°C 139-152 2 0.204 T a, annealing temperature of the primer pairs; H, Haploid genetic diversity Each forward primer was labeled with FAM, NED, VIC fluorescent dyes at 5′, respectively Table 2 Descriptive statistics and genetic diversity of ‘Candidatus Liberibacter asiaticus’ isolates across

seven microsatellite very loci in the samples obtained from nine different countries from Asia, North (Florida, USA) and South Americas (São Paulo, Brazil) Country Location ID Location Information Total number of individuals Number of individuals in clone corrected data Alleles per locus Haploid genetic diversity Brazil BRA São Paulo 22 14 2.7 0.313 USA FL-A Charlotte County, mTOR inhibitor Florida 5 4 1.6 0.161   FL-B Collier County, Florida 46 11 2.1 0.234   FL-C DeSoto County, Florida 30 5 1.7 0.194   FL-D Hardee County, Florida 8 5 1.7 0.160   FL-E Hendry County, Florida 13 5 1.6 0.171   FL-F Highlands County, Florida 19 6 1.7 0.119   FL-G Indian River, County, Florida 23 7 1.9 0.175   FL-H Martin County, Florida 10 7 1.9 0.175   FL-I Okechobee County, Florida 4 2 1.3 0.143   FL-J Polk County, Florida 6 4 2.0 0.304   FL-K St. Lucie County, Florida 6 4 1.4 0.179   FL-L Pasco County, Florida 2 2 1.1 0.071   FL-M Manatee County, Florida 2 2 1.3 0.143   FL-N Hillsborough County, Florida 2 2 1.3 0.071   FL-O Lake County, Florida 1 1 1.0 0.000   USA-Florida-overall 177 67 3.6 0.247 CHINA CHN-A Baise, Guangxi Province 3 2 1.1 0.071   CHN-B Guilin, Guangxi Province 3 3 1.4 0.

Comments are closed.