Table 3 Oligonucleotide primers used in this study Primer DNA sequence (5′ → 3′) Reference or source klh001 TTCGTCGTTGTAGTGAACC This study klh004 TGCCGTGTAAGTCATTCC This study 2426F ATGATATTGATTCTCGTTTGGT This selleck chemicals study 2426R TTAAGCGCTAAAACTGTATCCTTG This study 2426shF ATGAGTAGAATACTGTTAGTCGAT This study 2426shR TTAAGCGCTAAAACTGTATCC This study EMSA was performed in 20-μl reaction volumes containing 0.5X EMSA buffer [5 mM Tris-Cl (pH 8.0), 75 mM KCl, 0.05 mM DTT, 0.05 mM EDTA, 6% glycerol], 5 mM MgCl2, 20 mM Acetyl-PO4, 0.2 μg/μl poly(dI:dC), 0.2 μg/μl BSA, and 95 ng DIG-labeled DNA probe. Protein was added in concentrations ranging from 0.6 to 3.0 μg in increments of 0.6 μg. Reactions
were incubated at 16°C for 30 min. NP-40 was added to each reaction mixture at a concentration of 0.1% prior to Verubecestat purchase separation on a pre-run 5% polyacrylamide gel. Gels were stained with SYBR green and then transferred onto Hybond N+ (Amersham Biosciences, Piscataway, NJ). Probing and detection of DIG-labeled DNA was performed with the DIG Nucleic Acid Detection Kit according to the manufacturer’s protocol for colorimetric detection. Acknowledgements We thank Andrea McCarthy for assistance with the siderophore production assays and Mauricio Barajas for assistance with recombinant protein expression. This research was supported in part by the Office of Science (BER), U.S. Department of Energy, Grant No. DE-FG02-06ER64163, to DKT.
References 1. Raivio TL, {Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleck Anti-infection Compound Library|Selleck Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Selleckchem Anti-infection Compound Library|Selleckchem Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|Anti-infection Compound Library|Antiinfection Compound Library|buy Anti-infection Compound Library|Anti-infection Compound Library ic50|Anti-infection Compound Library price|Anti-infection Compound Library cost|Anti-infection Compound Library solubility dmso|Anti-infection Compound Library purchase|Anti-infection Compound Library manufacturer|Anti-infection Compound Library research buy|Anti-infection Compound Library order|Anti-infection Compound Library mouse|Anti-infection Compound Library chemical structure|Anti-infection Compound Library mw|Anti-infection Compound Library molecular weight|Anti-infection Compound Library datasheet|Anti-infection Compound Library supplier|Anti-infection Compound Library in vitro|Anti-infection Compound Library cell line|Anti-infection Compound Library concentration|Anti-infection Compound Library nmr|Anti-infection Compound Library in vivo|Anti-infection Compound Library clinical trial|Anti-infection Compound Library cell assay|Anti-infection Compound Library screening|Anti-infection Compound Library high throughput|buy Antiinfection Compound Library|Antiinfection Compound Library ic50|Antiinfection Compound Library price|Antiinfection Compound Library cost|Antiinfection Compound Library solubility dmso|Antiinfection Compound Library purchase|Antiinfection Compound Library manufacturer|Antiinfection Compound Library research buy|Antiinfection Compound Library order|Antiinfection Compound Library chemical structure|Antiinfection Compound Library datasheet|Antiinfection Compound Library supplier|Antiinfection Compound Library in vitro|Antiinfection Compound Library cell line|Antiinfection Compound Library concentration|Antiinfection Compound Library clinical trial|Antiinfection Compound Library cell assay|Antiinfection Compound Library screening|Antiinfection Compound Library high throughput|Anti-infection Compound high throughput screening| Silhavy TJ: Periplasmic stress and ECF sigma factors. Annu Rev Microbiol 2001, 55:591–624.PubMedCrossRef 2. West AH, Stock AM: Histidine
kinases and response regulator proteins in two-component signaling systems. Trends Biochem Sci 2001, ifoxetine 26:369–376.PubMedCrossRef 3. Ulrich LE, Koonin EV, Zhulin IB: One-component systems dominate signal transduction in prokaryotes. Trends Microbiol 2005, 13:52–56.PubMedCrossRef 4. Gueriri I, Cyncynatus C, Dubrac S, Arana AT, Dussurget O, Msadek T: The DegU orphan response regulator of Listeria monocytogenes autorepresses its own synthesis and is required for bacterial motility, virulence and biofilm formation. Microbiology 2008, 154:2251–2264.PubMedCrossRef 5. Delany I, Spohn G, Rappuoli R, Scarlato V: Growth phase-dependent regulation of target gene promoters for binding of the essential orphan response regulator HP1043 of Helicobacter pylori . J Bacteriol 2002, 184:4800–4810.PubMedCrossRef 6. Hong E, Lee HM, Ko H, Kim DU, Jeon BY, Jung J, Shin J, Lee SA, Kim Y, Jeon YH, et al.: Structure of an atypical orphan response regulator protein supports a new phosphorylation-independent regulatory mechanism. J Biol Chem 2007, 282:20667–20675.PubMedCrossRef 7. Pan X, Ge J, Li M, Wu B, Wang C, Wang J, Feng Y, Yin Z, Zheng F, Cheng G, et al.: The orphan response regulator CovR: a globally negative modulator of virulence in Streptococcus suis serotype 2. J Bacteriol 2009, 191:2601–2612.PubMedCrossRef 8.
