coli SM10λpir[16], mated into S. oneidensis MR-1 [9], and Gmr/Tcr single crossover recombinants were isolated. Following growth in LB liquid without selection, cultures of these single crossovers were plated to LB plates containing Gm, 5% sucrose (w/v), and 0.1% NaCl (instead of omiting NaCl to increase the likelihood of isolating an hfq mutant in the event that loss of hfq resulted in cells sensitive to hypoosmotic conditions). Gmr Sucr Tcs hfq∆ mutant candidates were screened via PCR and DNA sequencing of the disrupted region. The sequence of the primers used for diagnostic PCR in Figure

1 are as follows: A (hfq 5’ diagnostic) – ATAATGTGGTGCAATTTGCC; B (lacZ 5’ out) – CGTTGTAAAACGACGGGATCG; C (aacC1 3’out) – GATGCACTTTGATATCGACCC; D (hfq 3’ diagnostic) – GAGTCCAACCACGCACTAGG. Figure 1 Construction and verification of a null allele of the Shewanella oneidensis MR-1 hfq gene. (A) Knockout strategy for the MR-1 hfq gene. selleck chemical Most of the hfq gene coding sequence (all but the first 9 codons and last 6 codons) was replaced with a cassette containing a promoterless lacZ gene and a gentamicin resistance marker. (B) Agarose gel of analytical PCR reactions using wild

type MR-1 (lanes Selleck BVD-523 2–4) or hfq∆ mutant (lanes 5–7) templates and primers A, B, C, and D (see Materials and Methods for primer sequences) indicated with arrows on the diagram in panel (A) The size standard (M) in lane 1 is 1kb plus DNA ladder (Invitrogen). (C) Western blot of SDS-PAGE-fractionated total protein from various Shewanella strains probed with a polyclonal antibody raised against E. coli Hfq protein. Lanes 1 and 2: MR-1 containing pBBR1-MCS-2 (vector) or hfq rescue construct (phfq), respectively. Lanes 3 and 4: hfq∆ containing vector or phfq, respectively. The antibody detects both putative Hfq monomers (~10kDa)

as well as putative Hfq homohexamers (~60kDa). To generate an hfq rescue construct, we PCR amplified a 1.3kb genomic fragment containing the S. oneidensis MR-1 hfq coding sequence and ~1kb upstream of the hfq open reading frame. Based on hfq promoter analysis in E. coli, this fragment Staurosporine ic50 likely contains the native promoters for Urease S. oneidensis hfq[17]. A PCR product was generated using the 5’ primer GGCAAGCTTCAGGAAAAACGGCTTTAGCTCTCG and the 3’ primer GGCGGTACCACTAAACCTTATTCGCCACTTGGC. Following restriction with HindIII and KpnI, this PCR product was ligated to HindIII/KpnI restricted pBBR-1MCS2 [18]. The resulting plasmid, pBBR1-hfq, was transformed into E. coli S17-1λpir[19] and mated into S. oneidensis strains. In our hands, the pBBR1-MCS2 based vectors were stably maintained in S. oneidensis strains after 30 hours in LB Km cultures and after 120 hours in modified M1 Km cultures (data not shown). Western blot analyses 3ml aliquots of S. oneidensis cultures were pelleted in a microcentrifuge for 2’ at 20300 x g.