Cificity. A semi-quantitative analysis of Bendamustine Ribomustin type IV collagen, fibronectin 1 and flk was Z Select the number of clusters with strong, medium and low expression performed. A total of 40 glomeruli / animal gez Hlt. 2.8 The protein analysis by Western blot cryosections colon were weighed and homogenized in an ice-cold buffer. The homogenates were then centrifuged and the whichever type Walls were collected and 801c. The total protein concentration in the samples was measured by the Bicinchonins Acid method. Aliquots of whichever type Walls, the same amounts of proteins were evaluated to determine p67phox, Nox4, osteopontin and TGF b1. The expression of the above antibody Body was normalized by actin protein expression b in the same sample. The expression of phospho ERK1 / 2 was normalized by the basal level of ERK1 / 2. All prime Ren Antique Body were used at a dilution of 1:1000 and secondary Re Antique Body were used at a dilution of 1:5000. 2.9 A and B1 PKC activity was t of the renal cortex homogenized in buffer A. The cooled homogenates were centrifuged at 1000 g for 10 minutes. This whichever type Walls were then centrifuged at 10 000 g for 20 min at 41C. The supernatant was used as whole cell lysate. The whichever type Walls were then ultracentrifuged at 100 000 g for 1 h at 41C. The supernatant was obtained as the cytosolic fraction and the pellet was resuspended in buffer B and ultracentrifuged to 100 000 g for 1 h at 41C. The supernatant was obtained as the membrane fraction. Western blot was then to the cell lysate, cytosol and the membrane fraction using an antibody Rpers and carried out b1 and PKC activation was calculated from the ratio Ratio of the cytosolic membrane fractions derived. 2.10 Quantitative RT-PCR to detect p300 cha real response No time polymerase was performed as previously described, with the abundance of the transcripts expressed relative to that of GAPDH mRNA.
Nucleotide sequences of the primers and probes were GGGACTAACCAATGGTGGTG p300, ATTGG GAGAAGTCAAGCCTG, GAPDH GCTCATTTCCT GGTATGACAACG, AGGGGTCTACATGGCAACTG. 2.11 Analysis of statistical data is as per mean7SEM Presents and were followed by analysis of variance by Tukey methods for analysis and post hoc two-tailed t if n IST. A value of po0.05 was considered statistically significant. For statistical analysis, GraphPad Prism 5 software was used. 3 Results 3.1 Effect of curcumin treatment on the K Body weight, kidney weight / K Body weight, blood sugar, creatinine clearance, urea and urinary protein at the end of 11 weeks, diabetic rats showed a significant increase in plasma glucose levels and reduced the K body weight compared to normal rats. Chronic treatment with curcumin in diabetic rats 3 to materially impair 11wk Changed levels of plasma glucose compared to untreated rats. Treatment with curcumin also prevented weight loss in diabetic rats but this effect was not significant compared to untreated diabetic rats. Diabetic rats the kidney / K body weight, A marker for the development of DN obtained Ht, and the ratio Ratio significantly reduced by treatment with curcumin. Diabetic rats also showed increased Hte serum creatinine, urea, increases excretion of hte Eiwei and decreased plasma and CCR curcumin treatment significantly reduced.