2.1, Applied Bio systems). In the immune challenge experiments, F. indicus (approximately 10–20 g each) was maintained in 500 L tank filled with air pumped sea water. For the challenge test, there were three treatments (F. indicus injected with PG, V. parahaemolyticus and saline) combined with seven exposure times at 0, 3, 6, 12, 24, 36 and 48 h. Peptidoglycon (PG) isolated from Bacillus subtilis (69554, Sigma, USA) which had been dissolved in 0.85% NaCl solution BMS-754807 cell line to 1 mg ml−1. F. indicus was injected in the abdominal
side with PG solution at a rate of 20 μl per 20 g of shrimp to reach a dose of 1 mg kg−1. V. parahaemolyticus (accession no: HQ693275) was injected in each shrimp at a concentration of 6×10−4 CFU. Hemolymph was collected from the ventral sinus using a 1-mL sterile syringe preloaded with 100 μl anticoagulant at 0, 3, 6, 12, 24, 36, and 48 h post-injection. The hemolymph was centrifuged immediately at 800 g for 20 min at 4 °C for 20 min. anti-CTLA-4 antibody inhibitor The resulting pellet was used for total RNA isolation, and used for the Fein-Penaeidin transcript. Control groups were injected
with 20 μl saline. For each treatment and each exposure time, hemolymph were extracted from three shrimps. Quantitative RT-PCR was performed using the gene specific primers QFISP F (ATGCGTCTCGTGGTCTGCCT) with QFISP R (CCATAGGGTGGAGCTCTGGA). The primers β-actin F and β-actin R were used to amplify the β-actin fragment that was used as a positive control. The penaeidin cDNA of F. indicus (Fein-Penaeidin) consisted of 234 bp encoding 77 amino acids including an signal peptide of 19 amino acids ( Fig. 1). The calculated molecular mass of the mature protein is 8.335 kDa with an estimated Alectinib datasheet pI of 9.5. The signal peptide region of Fein-Penaeidin is highly conserved in all other crustacean penaeidins (MRLVVCLVSLASFALVCRA). Also the proline-rich residues at the NH2-terminus and the six cysteine residues at the
COOH-terminus are conserved and found homologous with other crustacean sequences. Gly (G), Arg (R), Cys (C) and Ala (A) are abundant in the Fein-Penaeidin sequence. The total numbers of negatively charged residues (Asp+Glu) were one while the numbers of positively charged residues (Arg+Lys) were ten. The estimated extinction coefficient was computed to be 7950 when all pairs of Cys residues form cystines and 7450 when all Cys residues are reduced. The estimated half-life is 30 h in mammalian reticulocytes, in vitro, >20 h in yeast, in vivo and >10 h (Escherichia coli, in vivo). The instability index (II) is computed to be 65.37 and this classifies the protein as unstable. The Aliphatic index and the Grand average of hydropathicity (GRAVY) were found to be 63.38 and −0.144, respectively. The nucleotide sequence and deduced amino acid sequence was submitted to GenBank (accession no: HM535649). According to the search data in the Gen Bank, comparision of full-length alignment of penaeidin of F. indicus with penaeidins of other Penaeid shrimps was performed by BLAST ( Fig.