​org/​) and then were searched in the GenomeNet (http://​www.​genome.​jp/​) to confirm the genomic organization. A selected

number of GluQ-RS enzymes were aligned using the MUSCLE algorithm [39] and analyzed using the maximum-likelihood method based on the JTT matrix-based model. The percentage of trees in which the associated proteins clustered together is shown next to the branches. The analysis INCB018424 price involved 54 amino acid sequences, including the GluRS proteins from Methanocaldococcus jannaschii and Archaeoglobus fulgidus as an outgroup. All positions containing gaps and missing data were eliminated. There were a total of 199 positions in the final dataset. Evolutionary analyses were conducted in MEGA5 [21]. RNA isolation and synthesis of cDNA Total mRNA was obtained during the growth of S. flexneri 2457T using the RNeasy mini kit following the supplier instructions (Qiagen). The purified nucleic acid was treated with RNase- free DNase (Fermentas) and its concentration was estimated by measuring the optical density at 260 nm (OD260). Approximately 1 μg of total RNA was subjected to reverse transcription using M-MuLV polymerase learn more (Fermentas) and random primers following the provider’s protocol. The cDNA was amplified using specific

PCR primers for each gene of interest (Table 2). Table 2 Primer sequences Name Sequence 5′- 3′ a Reference and characteristics opeF TAAGGAGAAGCAACATGCAAGA This work. RT-PCR of dksA operon from nucleotide +40 to +1477b opeR ATAGCTCAGCATGACGCATTT dksAF ATGCAAGAAGGGCAAAACCG This work. RT-PCR of dksA gene from nucleotide +54 to +488 dksAR GCGAATTTCAGCCAGCGTTT interF selleck products AGTGGAAGACGAAGATTTCG This work, RT-PCR of intergenic region from nucleotide +368 to +863 interR TCCTTGTTCATGTAACCAGG gQRSF TTCAAAGAGATGACAGACACACAG This work, RT-PCR of gluQ-rs gene

from nucleotide +567 to +1074 gQRSR CACGGCGATGAATGATAAAATC rrsHF CCTACGGGAGGCAGCAG [40] RT-PCR of ribosomal PLEKHB2 RNA 16S rrsHR CCCCCGTCAATTCCTTTGAGTTT pcnBR GATGGAGCCGAAAATGTTGT Reverse of pcnB gene from nucleotide +1993 PdksAF GGATCCAAGCGAAGTAAAATACGG BamHI site, from nucleotide −506 PdksARST AAGCTTGTGATGGAACGGCTGTAAT HindIII site, to nucleotide +527 PdksARCT AAGCTTCTGTGTGTCTGTCATCTCTTTG HindIII site, to nucleotide +590 PgluQF GGATCCAAGAAGGGCAAAACCGTA BamHI site, from nucleotide +58 TERGQ2 CCTTATTTTTTGTTCAAAGAGATGACAGACACACAGA Recognition from nucleotide +555 TERMGQ3 ATAAGGCGGGAGCATAACGGAGGAGTGGTAAAC Recognition from nucleotide +560, underline sequence are nucleotides changed M13R GCGGATAACAATTTCACACAGG Recognition site in pTZ57R/T ATGGQRSF GGATCCGTAATTACAGCCGTTCCATC BamHI site, from nucleotide +507. Underline nucleotides correspond to the stop codon of dksA ATGGQRSR CTCGAGGCATGACGCATTTGAGAATG XhoI site, to nucleotide +1469 virFF AGCTCAGGCAATGAAACTTTGAC [41] virFR TGGGCTTGATATTCCGATAAGTC aNucleotides in bold are indicated restriction site. bFragments cloned are indicated based on the transcription start of dksA identified by [25].